Incidental Mutation 'R0418:Il1rl2'
ID 36843
Institutional Source Beutler Lab
Gene Symbol Il1rl2
Ensembl Gene ENSMUSG00000070942
Gene Name interleukin 1 receptor-like 2
Synonyms
MMRRC Submission 038620-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0418 (G1)
Quality Score 168
Status Validated
Chromosome 1
Chromosomal Location 40324610-40367562 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40326502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 3 (V3A)
Ref Sequence ENSEMBL: ENSMUSP00000142248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095020] [ENSMUST00000193388] [ENSMUST00000194296]
AlphaFold Q9ERS7
Predicted Effect unknown
Transcript: ENSMUST00000095020
AA Change: V3A
SMART Domains Protein: ENSMUSP00000092630
Gene: ENSMUSG00000070942
AA Change: V3A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192551
Predicted Effect unknown
Transcript: ENSMUST00000193388
AA Change: V3A
SMART Domains Protein: ENSMUSP00000141507
Gene: ENSMUSG00000070942
AA Change: V3A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 29 115 3.1e-10 SMART
Pfam:Ig_2 127 167 2.4e-1 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194296
AA Change: V3A
SMART Domains Protein: ENSMUSP00000142248
Gene: ENSMUSG00000070942
AA Change: V3A

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. An experiment with transient gene expression demonstrated that this receptor was incapable of binding to interleukin 1 alpha and interleukin 1 beta with high affinity. This gene and four other interleukin 1 receptor family genes, including interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 1 (IL1RL1), and interleukin 18 receptor 1 (IL18R1), form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and overtly normal and have normal skin in an unchallenged context. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Il1rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Il1rl2 APN 1 40356814 splice site probably null
IGL02490:Il1rl2 APN 1 40356812 splice site probably benign
IGL03201:Il1rl2 APN 1 40343040 missense possibly damaging 0.95
IGL03269:Il1rl2 APN 1 40365312 missense probably damaging 1.00
R0088:Il1rl2 UTSW 1 40365053 missense possibly damaging 0.87
R0504:Il1rl2 UTSW 1 40329056 missense probably benign 0.00
R1629:Il1rl2 UTSW 1 40356860 missense probably benign 0.02
R1679:Il1rl2 UTSW 1 40343160 missense probably benign 0.36
R1680:Il1rl2 UTSW 1 40351793 missense possibly damaging 0.61
R1892:Il1rl2 UTSW 1 40327534 missense probably damaging 1.00
R1938:Il1rl2 UTSW 1 40363324 missense probably damaging 1.00
R2020:Il1rl2 UTSW 1 40365214 missense probably damaging 0.98
R4193:Il1rl2 UTSW 1 40365048 missense probably damaging 1.00
R4364:Il1rl2 UTSW 1 40351791 missense probably benign
R4365:Il1rl2 UTSW 1 40351791 missense probably benign
R4657:Il1rl2 UTSW 1 40327310 intron probably benign
R4840:Il1rl2 UTSW 1 40327387 missense possibly damaging 0.84
R4890:Il1rl2 UTSW 1 40327310 intron probably benign
R5051:Il1rl2 UTSW 1 40343094 missense probably benign 0.03
R5239:Il1rl2 UTSW 1 40365095 missense probably benign 0.03
R5447:Il1rl2 UTSW 1 40329156 missense probably damaging 1.00
R6013:Il1rl2 UTSW 1 40351857 missense possibly damaging 0.82
R6162:Il1rl2 UTSW 1 40351878 missense probably damaging 1.00
R6244:Il1rl2 UTSW 1 40327566 missense possibly damaging 0.78
R6798:Il1rl2 UTSW 1 40365240 missense probably damaging 1.00
R7667:Il1rl2 UTSW 1 40365253 missense probably damaging 0.99
R7855:Il1rl2 UTSW 1 40343119 missense probably damaging 1.00
R7857:Il1rl2 UTSW 1 40327482 missense probably benign 0.44
R8255:Il1rl2 UTSW 1 40365311 missense probably damaging 1.00
R8903:Il1rl2 UTSW 1 40327370 critical splice acceptor site probably null
R9236:Il1rl2 UTSW 1 40329061 missense probably damaging 1.00
R9448:Il1rl2 UTSW 1 40327444 missense probably benign 0.36
R9485:Il1rl2 UTSW 1 40327310 intron probably benign
R9487:Il1rl2 UTSW 1 40327310 intron probably benign
R9621:Il1rl2 UTSW 1 40327310 intron probably benign
R9746:Il1rl2 UTSW 1 40365359 missense possibly damaging 0.94
Z1177:Il1rl2 UTSW 1 40327310 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTTGATCCAAGTGCCAGCACATC -3'
(R):5'- TTTGACCGGCCTGCCAGATTATC -3'

Sequencing Primer
(F):5'- AGGCCAGTCGGCGTTTAC -3'
(R):5'- TTATCTGGTGGAAAGAGTGACTAGC -3'
Posted On 2013-05-09