Incidental Mutation 'R4790:Casp1'
ID368463
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Namecaspase 1
SynonymsICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
MMRRC Submission 042418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4790 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location5298517-5307265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5303020 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 158 (T158I)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
Predicted Effect probably benign
Transcript: ENSMUST00000027015
AA Change: T158I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: T158I

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
Abca5 T G 11: 110,311,410 T390P possibly damaging Het
Acss3 A T 10: 107,023,702 Y345* probably null Het
Adam26b A T 8: 43,520,727 S413T probably benign Het
Angpt2 T A 8: 18,714,082 Q148L probably damaging Het
Ank3 T A 10: 69,988,151 Y883* probably null Het
Ankrd52 A G 10: 128,380,945 K190E possibly damaging Het
Anks1b A G 10: 90,163,275 R415G probably damaging Het
Ano3 T A 2: 110,884,919 Q58L probably benign Het
Arhgap39 A T 15: 76,726,731 M924K possibly damaging Het
AU040320 A G 4: 126,847,215 M910V possibly damaging Het
BC051019 T A 7: 109,716,346 H86L probably benign Het
C1qbp G A 11: 70,980,030 Q151* probably null Het
C4b G T 17: 34,734,143 D1069E probably benign Het
C77080 C A 4: 129,223,302 R523L probably damaging Het
Casq1 T C 1: 172,216,837 D141G probably damaging Het
Ccdc33 T A 9: 58,029,957 E653V probably damaging Het
Cd180 C T 13: 102,702,822 T71M probably damaging Het
Cdk4 T C 10: 127,064,701 L112P probably damaging Het
Celf2 A G 2: 6,549,903 F425S probably damaging Het
Chrm3 A T 13: 9,877,662 V446E probably benign Het
Chst9 A T 18: 15,453,050 L152H probably damaging Het
Cib2 A G 9: 54,549,803 probably null Het
Clec18a T C 8: 111,072,085 S366G probably damaging Het
Crebbp A G 16: 4,180,119 F34L probably damaging Het
Dapk1 AT A 13: 60,723,105 probably null Het
Ddi1 T A 9: 6,265,761 M203L probably benign Het
Ddx20 G T 3: 105,683,169 S270R probably benign Het
Epp13 A T 7: 6,266,318 K31* probably null Het
Espnl A T 1: 91,344,424 E458V probably damaging Het
Fat3 T C 9: 15,998,484 D2074G probably damaging Het
Fcf1 A G 12: 84,974,128 T61A probably benign Het
Fkbp15 T C 4: 62,307,997 R772G probably benign Het
Flnb T C 14: 7,905,661 V1137A probably benign Het
Fosb C A 7: 19,309,388 C15F probably damaging Het
Frem2 A T 3: 53,516,741 W3092R probably benign Het
Gm3248 T C 14: 5,945,831 I28V probably damaging Het
Gm4922 G T 10: 18,784,168 L269I possibly damaging Het
Gucy2e G A 11: 69,228,448 R627W probably damaging Het
Hephl1 T A 9: 15,059,171 E1009V probably damaging Het
Hsf4 A T 8: 105,270,605 Q61L probably damaging Het
Itgam T A 7: 128,116,273 N1046K probably benign Het
Itgav G A 2: 83,755,810 C138Y probably damaging Het
Itih4 A T 14: 30,889,910 Y157F probably damaging Het
Kcnt2 C T 1: 140,354,516 R80C probably damaging Het
Kdm4b G A 17: 56,401,618 V986M probably damaging Het
Lamb3 T A 1: 193,339,886 V1014D probably damaging Het
Lrrc74b G T 16: 17,549,853 N282K probably damaging Het
Map3k20 T A 2: 72,441,704 H725Q probably benign Het
Mink1 A G 11: 70,599,041 N81S probably damaging Het
Mmp21 A G 7: 133,675,030 Y415H probably damaging Het
Mycbp2 A T 14: 103,229,437 W1297R probably damaging Het
Myh8 T C 11: 67,279,963 M95T probably damaging Het
Myo7b A T 18: 32,000,105 probably null Het
Nanog A G 6: 122,707,915 M20V probably benign Het
Ncapd3 A G 9: 27,051,850 I484V probably benign Het
Ndufa12 A T 10: 94,220,758 N116I probably benign Het
Nedd4l A G 18: 65,203,945 I668V possibly damaging Het
Nobox T C 6: 43,305,546 D309G probably benign Het
Npnt A G 3: 132,890,762 probably benign Het
Nrxn1 A C 17: 90,455,049 Y2D possibly damaging Het
Obox6 G T 7: 15,834,577 P125T possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1079 T C 2: 86,538,880 T10A possibly damaging Het
Olfr1193 T A 2: 88,678,387 N177K possibly damaging Het
Olfr1436 A G 19: 12,298,941 Y64H possibly damaging Het
Olfr202 A T 16: 59,284,458 V13D probably damaging Het
Olfr679 T C 7: 105,086,637 probably benign Het
Olfr697 C G 7: 106,741,791 V48L probably benign Het
Olfr761 T C 17: 37,952,742 Y94C probably damaging Het
Osm A T 11: 4,238,435 M21L probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otud4 T G 8: 79,666,773 S493A possibly damaging Het
Pars2 A G 4: 106,651,111 probably benign Het
Phlda3 T A 1: 135,766,819 V124E possibly damaging Het
Pias4 T C 10: 81,157,492 D199G probably damaging Het
Pm20d1 T C 1: 131,812,039 L375P probably benign Het
Pole2 T C 12: 69,226,365 I48V probably benign Het
Prrc2c T C 1: 162,710,481 R527G unknown Het
Rasgrf2 G T 13: 91,988,016 N592K probably damaging Het
Rbm7 A G 9: 48,495,174 L26P probably damaging Het
Rhag A G 17: 40,831,290 H208R probably benign Het
Rnf17 A G 14: 56,434,355 E268G probably damaging Het
Rnf220 A G 4: 117,289,055 V23A probably benign Het
Rnf7 A T 9: 96,478,419 V55D probably damaging Het
Sdr9c7 C A 10: 127,903,579 R188S possibly damaging Het
Senp6 T A 9: 80,089,858 N51K probably benign Het
Skint3 C A 4: 112,255,898 T235K possibly damaging Het
Slc10a5 A G 3: 10,335,036 F188S probably damaging Het
Slc41a1 G A 1: 131,830,952 G111R probably damaging Het
Smarca1 T C X: 47,884,067 D132G probably null Het
Snrnp48 C T 13: 38,221,323 R299W probably damaging Het
Sspo G A 6: 48,460,771 G1413D probably benign Het
Star T A 8: 25,808,616 H16Q probably damaging Het
Strc T C 2: 121,375,594 D779G probably benign Het
Sulf2 T C 2: 166,089,295 Y264C probably damaging Het
Supt7l A G 5: 31,522,904 S6P possibly damaging Het
Syne2 A G 12: 76,020,391 D4289G probably benign Het
Szrd1 A T 4: 141,139,690 probably null Het
Tada1 T C 1: 166,391,954 V275A possibly damaging Het
Tbr1 A T 2: 61,811,588 Y136F probably benign Het
Tbx20 T A 9: 24,725,714 H359L probably benign Het
Thbs4 G T 13: 92,762,806 D560E probably damaging Het
Tnfsf14 T C 17: 57,190,740 H164R probably damaging Het
Trmu T C 15: 85,882,805 S72P probably damaging Het
Tsnaxip1 C A 8: 105,833,523 Q36K probably benign Het
Ttc28 T A 5: 111,224,217 M844K possibly damaging Het
Tubgcp2 T C 7: 139,999,288 Y695C probably damaging Het
Ugt1a10 T A 1: 88,056,287 M269K probably damaging Het
Urb1 A T 16: 90,769,555 L1448* probably null Het
Vmn2r124 A T 17: 18,049,593 H37L probably damaging Het
Vmn2r44 T C 7: 8,367,950 N699S probably damaging Het
Vps35 A T 8: 85,278,857 probably null Het
Yipf1 G T 4: 107,336,199 probably null Het
Zfp395 A G 14: 65,386,541 N153S possibly damaging Het
Zfp395 A G 14: 65,393,207 D402G probably damaging Het
Zfp652 T C 11: 95,749,609 V120A probably damaging Het
Zp3r T C 1: 130,582,892 I364M probably damaging Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2316:Casp1 UTSW 9 5306213 missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R2885:Casp1 UTSW 9 5299851 missense probably benign 0.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4367:Casp1 UTSW 9 5299333 missense probably benign 0.41
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7215:Casp1 UTSW 9 5298523 utr 5 prime probably null
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
R8002:Casp1 UTSW 9 5303164 missense possibly damaging 0.94
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGCCTACCAGGTGTTTTC -3'
(R):5'- GCAAGGCTTCTGTAACATCTCTTC -3'

Sequencing Primer
(F):5'- AGAGCCTACCAGGTGTTTTCTAGAC -3'
(R):5'- CTCTTCTAGCATTTTCTAAGGGGAAG -3'
Posted On2016-02-04