Incidental Mutation 'R4790:Chrm3'
ID 368494
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, M3R, Chrm-3
MMRRC Submission 042418-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R4790 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 9925522-10410883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9927698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 446 (V446E)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect probably benign
Transcript: ENSMUST00000063093
AA Change: V446E

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: V446E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187510
AA Change: V446E

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: V446E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,202,236 (GRCm39) T390P possibly damaging Het
Acss3 A T 10: 106,859,563 (GRCm39) Y345* probably null Het
Adam26b A T 8: 43,973,764 (GRCm39) S413T probably benign Het
Angpt2 T A 8: 18,764,098 (GRCm39) Q148L probably damaging Het
Ank3 T A 10: 69,823,981 (GRCm39) Y883* probably null Het
Ankrd52 A G 10: 128,216,814 (GRCm39) K190E possibly damaging Het
Anks1b A G 10: 89,999,137 (GRCm39) R415G probably damaging Het
Ano3 T A 2: 110,715,264 (GRCm39) Q58L probably benign Het
Aoc1l2 T A 6: 48,907,486 (GRCm39) I162N probably damaging Het
Arhgap39 A T 15: 76,610,931 (GRCm39) M924K possibly damaging Het
AU040320 A G 4: 126,741,008 (GRCm39) M910V possibly damaging Het
BC051019 T A 7: 109,315,553 (GRCm39) H86L probably benign Het
C1qbp G A 11: 70,870,856 (GRCm39) Q151* probably null Het
C4b G T 17: 34,953,117 (GRCm39) D1069E probably benign Het
Casp1 C T 9: 5,303,020 (GRCm39) T158I probably benign Het
Casq1 T C 1: 172,044,404 (GRCm39) D141G probably damaging Het
Ccdc33 T A 9: 57,937,240 (GRCm39) E653V probably damaging Het
Cd180 C T 13: 102,839,330 (GRCm39) T71M probably damaging Het
Cdk4 T C 10: 126,900,570 (GRCm39) L112P probably damaging Het
Celf2 A G 2: 6,554,714 (GRCm39) F425S probably damaging Het
Chst9 A T 18: 15,586,107 (GRCm39) L152H probably damaging Het
Cib2 A G 9: 54,457,087 (GRCm39) probably null Het
Clec18a T C 8: 111,798,717 (GRCm39) S366G probably damaging Het
Crebbp A G 16: 3,997,983 (GRCm39) F34L probably damaging Het
Dapk1 AT A 13: 60,870,919 (GRCm39) probably null Het
Ddi1 T A 9: 6,265,761 (GRCm39) M203L probably benign Het
Ddx20 G T 3: 105,590,485 (GRCm39) S270R probably benign Het
Eddm13 A T 7: 6,269,317 (GRCm39) K31* probably null Het
Espnl A T 1: 91,272,146 (GRCm39) E458V probably damaging Het
Fat3 T C 9: 15,909,780 (GRCm39) D2074G probably damaging Het
Fcf1 A G 12: 85,020,902 (GRCm39) T61A probably benign Het
Fkbp15 T C 4: 62,226,234 (GRCm39) R772G probably benign Het
Flnb T C 14: 7,905,661 (GRCm38) V1137A probably benign Het
Fosb C A 7: 19,043,313 (GRCm39) C15F probably damaging Het
Frem2 A T 3: 53,424,162 (GRCm39) W3092R probably benign Het
Gm3248 T C 14: 5,945,831 (GRCm38) I28V probably damaging Het
Gm4922 G T 10: 18,659,916 (GRCm39) L269I possibly damaging Het
Gucy2e G A 11: 69,119,274 (GRCm39) R627W probably damaging Het
Hephl1 T A 9: 14,970,467 (GRCm39) E1009V probably damaging Het
Hsf4 A T 8: 105,997,237 (GRCm39) Q61L probably damaging Het
Itgam T A 7: 127,715,445 (GRCm39) N1046K probably benign Het
Itgav G A 2: 83,586,154 (GRCm39) C138Y probably damaging Het
Itih4 A T 14: 30,611,867 (GRCm39) Y157F probably damaging Het
Kcnt2 C T 1: 140,282,254 (GRCm39) R80C probably damaging Het
Kdm4b G A 17: 56,708,618 (GRCm39) V986M probably damaging Het
Lamb3 T A 1: 193,022,194 (GRCm39) V1014D probably damaging Het
Lrrc74b G T 16: 17,367,717 (GRCm39) N282K probably damaging Het
Map3k20 T A 2: 72,272,048 (GRCm39) H725Q probably benign Het
Mink1 A G 11: 70,489,867 (GRCm39) N81S probably damaging Het
Mmp21 A G 7: 133,276,759 (GRCm39) Y415H probably damaging Het
Mycbp2 A T 14: 103,466,873 (GRCm39) W1297R probably damaging Het
Myh8 T C 11: 67,170,789 (GRCm39) M95T probably damaging Het
Myo7b A T 18: 32,133,158 (GRCm39) probably null Het
Nanog A G 6: 122,684,874 (GRCm39) M20V probably benign Het
Ncapd3 A G 9: 26,963,146 (GRCm39) I484V probably benign Het
Ndufa12 A T 10: 94,056,620 (GRCm39) N116I probably benign Het
Nedd4l A G 18: 65,337,016 (GRCm39) I668V possibly damaging Het
Nhsl3 C A 4: 129,117,095 (GRCm39) R523L probably damaging Het
Nobox T C 6: 43,282,480 (GRCm39) D309G probably benign Het
Npnt A G 3: 132,596,523 (GRCm39) probably benign Het
Nrxn1 A C 17: 90,762,477 (GRCm39) Y2D possibly damaging Het
Obox6 G T 7: 15,568,502 (GRCm39) P125T possibly damaging Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or14j8 T C 17: 38,263,633 (GRCm39) Y94C probably damaging Het
Or2ag15 C G 7: 106,340,998 (GRCm39) V48L probably benign Het
Or4s2b T A 2: 88,508,731 (GRCm39) N177K possibly damaging Het
Or56a3 T C 7: 104,735,844 (GRCm39) probably benign Het
Or5ac20 A T 16: 59,104,821 (GRCm39) V13D probably damaging Het
Or5an10 A G 19: 12,276,305 (GRCm39) Y64H possibly damaging Het
Or8k32 T C 2: 86,369,224 (GRCm39) T10A possibly damaging Het
Osm A T 11: 4,188,435 (GRCm39) M21L probably benign Het
Otogl T A 10: 107,657,894 (GRCm39) probably null Het
Otud4 T G 8: 80,393,402 (GRCm39) S493A possibly damaging Het
Pars2 A G 4: 106,508,308 (GRCm39) probably benign Het
Phlda3 T A 1: 135,694,557 (GRCm39) V124E possibly damaging Het
Pias4 T C 10: 80,993,326 (GRCm39) D199G probably damaging Het
Pm20d1 T C 1: 131,739,777 (GRCm39) L375P probably benign Het
Pole2 T C 12: 69,273,139 (GRCm39) I48V probably benign Het
Prrc2c T C 1: 162,538,050 (GRCm39) R527G unknown Het
Rasgrf2 G T 13: 92,136,135 (GRCm39) N592K probably damaging Het
Rbm7 A G 9: 48,406,474 (GRCm39) L26P probably damaging Het
Rhag A G 17: 41,142,181 (GRCm39) H208R probably benign Het
Rnf17 A G 14: 56,671,812 (GRCm39) E268G probably damaging Het
Rnf220 A G 4: 117,146,252 (GRCm39) V23A probably benign Het
Rnf7 A T 9: 96,360,472 (GRCm39) V55D probably damaging Het
Sdr9c7 C A 10: 127,739,448 (GRCm39) R188S possibly damaging Het
Senp6 T A 9: 79,997,140 (GRCm39) N51K probably benign Het
Skint3 C A 4: 112,113,095 (GRCm39) T235K possibly damaging Het
Slc10a5 A G 3: 10,400,096 (GRCm39) F188S probably damaging Het
Slc41a1 G A 1: 131,758,690 (GRCm39) G111R probably damaging Het
Smarca1 T C X: 46,972,944 (GRCm39) D132G probably null Het
Snrnp48 C T 13: 38,405,299 (GRCm39) R299W probably damaging Het
Sspo G A 6: 48,437,705 (GRCm39) G1413D probably benign Het
Star T A 8: 26,298,644 (GRCm39) H16Q probably damaging Het
Strc T C 2: 121,206,075 (GRCm39) D779G probably benign Het
Sulf2 T C 2: 165,931,215 (GRCm39) Y264C probably damaging Het
Supt7l A G 5: 31,680,248 (GRCm39) S6P possibly damaging Het
Syne2 A G 12: 76,067,165 (GRCm39) D4289G probably benign Het
Szrd1 A T 4: 140,867,001 (GRCm39) probably null Het
Tada1 T C 1: 166,219,523 (GRCm39) V275A possibly damaging Het
Tbr1 A T 2: 61,641,932 (GRCm39) Y136F probably benign Het
Tbx20 T A 9: 24,637,010 (GRCm39) H359L probably benign Het
Thbs4 G T 13: 92,899,314 (GRCm39) D560E probably damaging Het
Tnfsf14 T C 17: 57,497,740 (GRCm39) H164R probably damaging Het
Trmu T C 15: 85,767,006 (GRCm39) S72P probably damaging Het
Tsnaxip1 C A 8: 106,560,155 (GRCm39) Q36K probably benign Het
Ttc28 T A 5: 111,372,083 (GRCm39) M844K possibly damaging Het
Tubgcp2 T C 7: 139,579,201 (GRCm39) Y695C probably damaging Het
Ugt1a10 T A 1: 87,984,009 (GRCm39) M269K probably damaging Het
Urb1 A T 16: 90,566,443 (GRCm39) L1448* probably null Het
Vmn2r124 A T 17: 18,269,855 (GRCm39) H37L probably damaging Het
Vmn2r44 T C 7: 8,370,949 (GRCm39) N699S probably damaging Het
Vps35 A T 8: 86,005,486 (GRCm39) probably null Het
Yipf1 G T 4: 107,193,396 (GRCm39) probably null Het
Zfp395 A G 14: 65,623,990 (GRCm39) N153S possibly damaging Het
Zfp395 A G 14: 65,630,656 (GRCm39) D402G probably damaging Het
Zfp652 T C 11: 95,640,435 (GRCm39) V120A probably damaging Het
Zp3r T C 1: 130,510,629 (GRCm39) I364M probably damaging Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9,928,634 (GRCm39) missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9,927,314 (GRCm39) missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9,928,500 (GRCm39) nonsense probably null
IGL03085:Chrm3 APN 13 9,927,570 (GRCm39) missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9,928,220 (GRCm39) missense probably benign 0.22
R0147:Chrm3 UTSW 13 9,928,780 (GRCm39) missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9,927,969 (GRCm39) missense probably benign 0.10
R0544:Chrm3 UTSW 13 9,927,615 (GRCm39) missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9,928,350 (GRCm39) missense possibly damaging 0.82
R1647:Chrm3 UTSW 13 9,928,461 (GRCm39) missense probably damaging 1.00
R1697:Chrm3 UTSW 13 9,928,794 (GRCm39) missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9,927,452 (GRCm39) missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9,928,517 (GRCm39) missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9,928,371 (GRCm39) missense probably damaging 1.00
R2909:Chrm3 UTSW 13 9,928,033 (GRCm39) missense probably benign 0.43
R4212:Chrm3 UTSW 13 9,927,791 (GRCm39) missense probably benign 0.01
R4422:Chrm3 UTSW 13 9,928,591 (GRCm39) nonsense probably null
R4934:Chrm3 UTSW 13 9,927,450 (GRCm39) missense probably damaging 1.00
R5353:Chrm3 UTSW 13 9,928,593 (GRCm39) missense probably damaging 1.00
R5623:Chrm3 UTSW 13 9,927,423 (GRCm39) missense possibly damaging 0.92
R6154:Chrm3 UTSW 13 9,928,476 (GRCm39) missense possibly damaging 0.88
R6416:Chrm3 UTSW 13 9,927,698 (GRCm39) missense probably benign
R6693:Chrm3 UTSW 13 9,927,458 (GRCm39) missense probably benign 0.27
R7135:Chrm3 UTSW 13 9,927,837 (GRCm39) missense probably benign 0.00
R7297:Chrm3 UTSW 13 9,927,869 (GRCm39) missense probably benign 0.01
R7423:Chrm3 UTSW 13 9,928,845 (GRCm39) missense probably benign
R7591:Chrm3 UTSW 13 9,927,349 (GRCm39) nonsense probably null
R8353:Chrm3 UTSW 13 9,927,267 (GRCm39) makesense probably null
R8355:Chrm3 UTSW 13 9,928,646 (GRCm39) missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9,928,338 (GRCm39) missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9,927,267 (GRCm39) makesense probably null
R9227:Chrm3 UTSW 13 9,928,479 (GRCm39) missense probably benign 0.00
R9230:Chrm3 UTSW 13 9,928,479 (GRCm39) missense probably benign 0.00
R9336:Chrm3 UTSW 13 9,928,652 (GRCm39) missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9,927,437 (GRCm39) missense
R9537:Chrm3 UTSW 13 9,927,462 (GRCm39) missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9,927,480 (GRCm39) missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9,927,756 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTCCACGTGATGATGAAAGC -3'
(R):5'- GGGTCATAGCACCATCCTCAAC -3'

Sequencing Primer
(F):5'- CCAGCAAGATGGCACTGAGTG -3'
(R):5'- CTCCTCAGATAACCTGCAGG -3'
Posted On 2016-02-04