Incidental Mutation 'R4790:C4b'
ID368518
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 042418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4790 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34734143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1069 (D1069E)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: D1069E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D1069E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
Abca5 T G 11: 110,311,410 T390P possibly damaging Het
Acss3 A T 10: 107,023,702 Y345* probably null Het
Adam26b A T 8: 43,520,727 S413T probably benign Het
Angpt2 T A 8: 18,714,082 Q148L probably damaging Het
Ank3 T A 10: 69,988,151 Y883* probably null Het
Ankrd52 A G 10: 128,380,945 K190E possibly damaging Het
Anks1b A G 10: 90,163,275 R415G probably damaging Het
Ano3 T A 2: 110,884,919 Q58L probably benign Het
Arhgap39 A T 15: 76,726,731 M924K possibly damaging Het
AU040320 A G 4: 126,847,215 M910V possibly damaging Het
BC051019 T A 7: 109,716,346 H86L probably benign Het
C1qbp G A 11: 70,980,030 Q151* probably null Het
C77080 C A 4: 129,223,302 R523L probably damaging Het
Casp1 C T 9: 5,303,020 T158I probably benign Het
Casq1 T C 1: 172,216,837 D141G probably damaging Het
Ccdc33 T A 9: 58,029,957 E653V probably damaging Het
Cd180 C T 13: 102,702,822 T71M probably damaging Het
Cdk4 T C 10: 127,064,701 L112P probably damaging Het
Celf2 A G 2: 6,549,903 F425S probably damaging Het
Chrm3 A T 13: 9,877,662 V446E probably benign Het
Chst9 A T 18: 15,453,050 L152H probably damaging Het
Cib2 A G 9: 54,549,803 probably null Het
Clec18a T C 8: 111,072,085 S366G probably damaging Het
Crebbp A G 16: 4,180,119 F34L probably damaging Het
Dapk1 AT A 13: 60,723,105 probably null Het
Ddi1 T A 9: 6,265,761 M203L probably benign Het
Ddx20 G T 3: 105,683,169 S270R probably benign Het
Epp13 A T 7: 6,266,318 K31* probably null Het
Espnl A T 1: 91,344,424 E458V probably damaging Het
Fat3 T C 9: 15,998,484 D2074G probably damaging Het
Fcf1 A G 12: 84,974,128 T61A probably benign Het
Fkbp15 T C 4: 62,307,997 R772G probably benign Het
Flnb T C 14: 7,905,661 V1137A probably benign Het
Fosb C A 7: 19,309,388 C15F probably damaging Het
Frem2 A T 3: 53,516,741 W3092R probably benign Het
Gm3248 T C 14: 5,945,831 I28V probably damaging Het
Gm4922 G T 10: 18,784,168 L269I possibly damaging Het
Gucy2e G A 11: 69,228,448 R627W probably damaging Het
Hephl1 T A 9: 15,059,171 E1009V probably damaging Het
Hsf4 A T 8: 105,270,605 Q61L probably damaging Het
Itgam T A 7: 128,116,273 N1046K probably benign Het
Itgav G A 2: 83,755,810 C138Y probably damaging Het
Itih4 A T 14: 30,889,910 Y157F probably damaging Het
Kcnt2 C T 1: 140,354,516 R80C probably damaging Het
Kdm4b G A 17: 56,401,618 V986M probably damaging Het
Lamb3 T A 1: 193,339,886 V1014D probably damaging Het
Lrrc74b G T 16: 17,549,853 N282K probably damaging Het
Map3k20 T A 2: 72,441,704 H725Q probably benign Het
Mink1 A G 11: 70,599,041 N81S probably damaging Het
Mmp21 A G 7: 133,675,030 Y415H probably damaging Het
Mycbp2 A T 14: 103,229,437 W1297R probably damaging Het
Myh8 T C 11: 67,279,963 M95T probably damaging Het
Myo7b A T 18: 32,000,105 probably null Het
Nanog A G 6: 122,707,915 M20V probably benign Het
Ncapd3 A G 9: 27,051,850 I484V probably benign Het
Ndufa12 A T 10: 94,220,758 N116I probably benign Het
Nedd4l A G 18: 65,203,945 I668V possibly damaging Het
Nobox T C 6: 43,305,546 D309G probably benign Het
Npnt A G 3: 132,890,762 probably benign Het
Nrxn1 A C 17: 90,455,049 Y2D possibly damaging Het
Obox6 G T 7: 15,834,577 P125T possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1079 T C 2: 86,538,880 T10A possibly damaging Het
Olfr1193 T A 2: 88,678,387 N177K possibly damaging Het
Olfr1436 A G 19: 12,298,941 Y64H possibly damaging Het
Olfr202 A T 16: 59,284,458 V13D probably damaging Het
Olfr679 T C 7: 105,086,637 probably benign Het
Olfr697 C G 7: 106,741,791 V48L probably benign Het
Olfr761 T C 17: 37,952,742 Y94C probably damaging Het
Osm A T 11: 4,238,435 M21L probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otud4 T G 8: 79,666,773 S493A possibly damaging Het
Pars2 A G 4: 106,651,111 probably benign Het
Phlda3 T A 1: 135,766,819 V124E possibly damaging Het
Pias4 T C 10: 81,157,492 D199G probably damaging Het
Pm20d1 T C 1: 131,812,039 L375P probably benign Het
Pole2 T C 12: 69,226,365 I48V probably benign Het
Prrc2c T C 1: 162,710,481 R527G unknown Het
Rasgrf2 G T 13: 91,988,016 N592K probably damaging Het
Rbm7 A G 9: 48,495,174 L26P probably damaging Het
Rhag A G 17: 40,831,290 H208R probably benign Het
Rnf17 A G 14: 56,434,355 E268G probably damaging Het
Rnf220 A G 4: 117,289,055 V23A probably benign Het
Rnf7 A T 9: 96,478,419 V55D probably damaging Het
Sdr9c7 C A 10: 127,903,579 R188S possibly damaging Het
Senp6 T A 9: 80,089,858 N51K probably benign Het
Skint3 C A 4: 112,255,898 T235K possibly damaging Het
Slc10a5 A G 3: 10,335,036 F188S probably damaging Het
Slc41a1 G A 1: 131,830,952 G111R probably damaging Het
Smarca1 T C X: 47,884,067 D132G probably null Het
Snrnp48 C T 13: 38,221,323 R299W probably damaging Het
Sspo G A 6: 48,460,771 G1413D probably benign Het
Star T A 8: 25,808,616 H16Q probably damaging Het
Strc T C 2: 121,375,594 D779G probably benign Het
Sulf2 T C 2: 166,089,295 Y264C probably damaging Het
Supt7l A G 5: 31,522,904 S6P possibly damaging Het
Syne2 A G 12: 76,020,391 D4289G probably benign Het
Szrd1 A T 4: 141,139,690 probably null Het
Tada1 T C 1: 166,391,954 V275A possibly damaging Het
Tbr1 A T 2: 61,811,588 Y136F probably benign Het
Tbx20 T A 9: 24,725,714 H359L probably benign Het
Thbs4 G T 13: 92,762,806 D560E probably damaging Het
Tnfsf14 T C 17: 57,190,740 H164R probably damaging Het
Trmu T C 15: 85,882,805 S72P probably damaging Het
Tsnaxip1 C A 8: 105,833,523 Q36K probably benign Het
Ttc28 T A 5: 111,224,217 M844K possibly damaging Het
Tubgcp2 T C 7: 139,999,288 Y695C probably damaging Het
Ugt1a10 T A 1: 88,056,287 M269K probably damaging Het
Urb1 A T 16: 90,769,555 L1448* probably null Het
Vmn2r124 A T 17: 18,049,593 H37L probably damaging Het
Vmn2r44 T C 7: 8,367,950 N699S probably damaging Het
Vps35 A T 8: 85,278,857 probably null Het
Yipf1 G T 4: 107,336,199 probably null Het
Zfp395 A G 14: 65,386,541 N153S possibly damaging Het
Zfp395 A G 14: 65,393,207 D402G probably damaging Het
Zfp652 T C 11: 95,749,609 V120A probably damaging Het
Zp3r T C 1: 130,582,892 I364M probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
aspiration UTSW 17 34734442 missense probably benign 0.00
inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGACTGGACATGGGTCGTG -3'
(R):5'- TGAAACAAAGGACCATGCTGTG -3'

Sequencing Primer
(F):5'- TCGTGGAAGGAGCCATCAC -3'
(R):5'- TCTGATCCAAAAAGGTTCTGGG -3'
Posted On2016-02-04