Incidental Mutation 'R4790:Nrxn1'
ID368523
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Nameneurexin I
Synonymsneurexin I beta, alpha-latrotoxin receptor (calcium-dependent), A230068P09Rik, neurexin I alpha, neurexin I alpha, neurexin I beta, 1700062G21Rik, 9330127H16Rik, neurexin I alpha, neurexin I beta
MMRRC Submission 042418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4790 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location90033631-91093071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90455049 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 2 (Y2D)
Ref Sequence ENSEMBL: ENSMUSP00000133724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000159778] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000172466] [ENSMUST00000174331] [ENSMUST00000174337] [ENSMUST00000176118]
Predicted Effect probably benign
Transcript: ENSMUST00000054059
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072671
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097270
Predicted Effect unknown
Transcript: ENSMUST00000159778
AA Change: Y2D
SMART Domains Protein: ENSMUSP00000125561
Gene: ENSMUSG00000024109
AA Change: Y2D

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 284 418 2.3e-36 SMART
LamG 472 624 2.74e-43 SMART
EGF 651 685 1.58e-3 SMART
LamG 710 849 7.27e-25 SMART
LamG 897 1033 8.46e-35 SMART
EGF 1058 1092 1.87e1 SMART
LamG 1120 1277 7.74e-20 SMART
low complexity region 1304 1335 N/A INTRINSIC
low complexity region 1403 1418 N/A INTRINSIC
4.1m 1421 1439 1.19e-6 SMART
low complexity region 1458 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160800
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160844
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161102
Predicted Effect probably benign
Transcript: ENSMUST00000161402
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172466
AA Change: Y2D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134402
Gene: ENSMUSG00000024109
AA Change: Y2D

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
LamG 109 266 7.74e-20 SMART
low complexity region 293 324 N/A INTRINSIC
low complexity region 395 410 N/A INTRINSIC
4.1m 413 431 1.19e-6 SMART
low complexity region 450 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174331
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174337
AA Change: Y2D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133724
Gene: ENSMUSG00000024109
AA Change: Y2D

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
LamG 109 236 3.29e-23 SMART
low complexity region 263 294 N/A INTRINSIC
low complexity region 365 380 N/A INTRINSIC
4.1m 383 401 1.19e-6 SMART
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176118
SMART Domains Protein: ENSMUSP00000135241
Gene: ENSMUSG00000024109

DomainStartEndE-ValueType
Pfam:Laminin_G_2 1 95 3.1e-18 PFAM
Pfam:Laminin_G_1 1 98 3.7e-12 PFAM
EGF 129 163 1.87e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196269
Predicted Effect probably benign
Transcript: ENSMUST00000196559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198899
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
Abca5 T G 11: 110,311,410 T390P possibly damaging Het
Acss3 A T 10: 107,023,702 Y345* probably null Het
Adam26b A T 8: 43,520,727 S413T probably benign Het
Angpt2 T A 8: 18,714,082 Q148L probably damaging Het
Ank3 T A 10: 69,988,151 Y883* probably null Het
Ankrd52 A G 10: 128,380,945 K190E possibly damaging Het
Anks1b A G 10: 90,163,275 R415G probably damaging Het
Ano3 T A 2: 110,884,919 Q58L probably benign Het
Arhgap39 A T 15: 76,726,731 M924K possibly damaging Het
AU040320 A G 4: 126,847,215 M910V possibly damaging Het
BC051019 T A 7: 109,716,346 H86L probably benign Het
C1qbp G A 11: 70,980,030 Q151* probably null Het
C4b G T 17: 34,734,143 D1069E probably benign Het
C77080 C A 4: 129,223,302 R523L probably damaging Het
Casp1 C T 9: 5,303,020 T158I probably benign Het
Casq1 T C 1: 172,216,837 D141G probably damaging Het
Ccdc33 T A 9: 58,029,957 E653V probably damaging Het
Cd180 C T 13: 102,702,822 T71M probably damaging Het
Cdk4 T C 10: 127,064,701 L112P probably damaging Het
Celf2 A G 2: 6,549,903 F425S probably damaging Het
Chrm3 A T 13: 9,877,662 V446E probably benign Het
Chst9 A T 18: 15,453,050 L152H probably damaging Het
Cib2 A G 9: 54,549,803 probably null Het
Clec18a T C 8: 111,072,085 S366G probably damaging Het
Crebbp A G 16: 4,180,119 F34L probably damaging Het
Dapk1 AT A 13: 60,723,105 probably null Het
Ddi1 T A 9: 6,265,761 M203L probably benign Het
Ddx20 G T 3: 105,683,169 S270R probably benign Het
Epp13 A T 7: 6,266,318 K31* probably null Het
Espnl A T 1: 91,344,424 E458V probably damaging Het
Fat3 T C 9: 15,998,484 D2074G probably damaging Het
Fcf1 A G 12: 84,974,128 T61A probably benign Het
Fkbp15 T C 4: 62,307,997 R772G probably benign Het
Flnb T C 14: 7,905,661 V1137A probably benign Het
Fosb C A 7: 19,309,388 C15F probably damaging Het
Frem2 A T 3: 53,516,741 W3092R probably benign Het
Gm3248 T C 14: 5,945,831 I28V probably damaging Het
Gm4922 G T 10: 18,784,168 L269I possibly damaging Het
Gucy2e G A 11: 69,228,448 R627W probably damaging Het
Hephl1 T A 9: 15,059,171 E1009V probably damaging Het
Hsf4 A T 8: 105,270,605 Q61L probably damaging Het
Itgam T A 7: 128,116,273 N1046K probably benign Het
Itgav G A 2: 83,755,810 C138Y probably damaging Het
Itih4 A T 14: 30,889,910 Y157F probably damaging Het
Kcnt2 C T 1: 140,354,516 R80C probably damaging Het
Kdm4b G A 17: 56,401,618 V986M probably damaging Het
Lamb3 T A 1: 193,339,886 V1014D probably damaging Het
Lrrc74b G T 16: 17,549,853 N282K probably damaging Het
Map3k20 T A 2: 72,441,704 H725Q probably benign Het
Mink1 A G 11: 70,599,041 N81S probably damaging Het
Mmp21 A G 7: 133,675,030 Y415H probably damaging Het
Mycbp2 A T 14: 103,229,437 W1297R probably damaging Het
Myh8 T C 11: 67,279,963 M95T probably damaging Het
Myo7b A T 18: 32,000,105 probably null Het
Nanog A G 6: 122,707,915 M20V probably benign Het
Ncapd3 A G 9: 27,051,850 I484V probably benign Het
Ndufa12 A T 10: 94,220,758 N116I probably benign Het
Nedd4l A G 18: 65,203,945 I668V possibly damaging Het
Nobox T C 6: 43,305,546 D309G probably benign Het
Npnt A G 3: 132,890,762 probably benign Het
Obox6 G T 7: 15,834,577 P125T possibly damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1079 T C 2: 86,538,880 T10A possibly damaging Het
Olfr1193 T A 2: 88,678,387 N177K possibly damaging Het
Olfr1436 A G 19: 12,298,941 Y64H possibly damaging Het
Olfr202 A T 16: 59,284,458 V13D probably damaging Het
Olfr679 T C 7: 105,086,637 probably benign Het
Olfr697 C G 7: 106,741,791 V48L probably benign Het
Olfr761 T C 17: 37,952,742 Y94C probably damaging Het
Osm A T 11: 4,238,435 M21L probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otud4 T G 8: 79,666,773 S493A possibly damaging Het
Pars2 A G 4: 106,651,111 probably benign Het
Phlda3 T A 1: 135,766,819 V124E possibly damaging Het
Pias4 T C 10: 81,157,492 D199G probably damaging Het
Pm20d1 T C 1: 131,812,039 L375P probably benign Het
Pole2 T C 12: 69,226,365 I48V probably benign Het
Prrc2c T C 1: 162,710,481 R527G unknown Het
Rasgrf2 G T 13: 91,988,016 N592K probably damaging Het
Rbm7 A G 9: 48,495,174 L26P probably damaging Het
Rhag A G 17: 40,831,290 H208R probably benign Het
Rnf17 A G 14: 56,434,355 E268G probably damaging Het
Rnf220 A G 4: 117,289,055 V23A probably benign Het
Rnf7 A T 9: 96,478,419 V55D probably damaging Het
Sdr9c7 C A 10: 127,903,579 R188S possibly damaging Het
Senp6 T A 9: 80,089,858 N51K probably benign Het
Skint3 C A 4: 112,255,898 T235K possibly damaging Het
Slc10a5 A G 3: 10,335,036 F188S probably damaging Het
Slc41a1 G A 1: 131,830,952 G111R probably damaging Het
Smarca1 T C X: 47,884,067 D132G probably null Het
Snrnp48 C T 13: 38,221,323 R299W probably damaging Het
Sspo G A 6: 48,460,771 G1413D probably benign Het
Star T A 8: 25,808,616 H16Q probably damaging Het
Strc T C 2: 121,375,594 D779G probably benign Het
Sulf2 T C 2: 166,089,295 Y264C probably damaging Het
Supt7l A G 5: 31,522,904 S6P possibly damaging Het
Syne2 A G 12: 76,020,391 D4289G probably benign Het
Szrd1 A T 4: 141,139,690 probably null Het
Tada1 T C 1: 166,391,954 V275A possibly damaging Het
Tbr1 A T 2: 61,811,588 Y136F probably benign Het
Tbx20 T A 9: 24,725,714 H359L probably benign Het
Thbs4 G T 13: 92,762,806 D560E probably damaging Het
Tnfsf14 T C 17: 57,190,740 H164R probably damaging Het
Trmu T C 15: 85,882,805 S72P probably damaging Het
Tsnaxip1 C A 8: 105,833,523 Q36K probably benign Het
Ttc28 T A 5: 111,224,217 M844K possibly damaging Het
Tubgcp2 T C 7: 139,999,288 Y695C probably damaging Het
Ugt1a10 T A 1: 88,056,287 M269K probably damaging Het
Urb1 A T 16: 90,769,555 L1448* probably null Het
Vmn2r124 A T 17: 18,049,593 H37L probably damaging Het
Vmn2r44 T C 7: 8,367,950 N699S probably damaging Het
Vps35 A T 8: 85,278,857 probably null Het
Yipf1 G T 4: 107,336,199 probably null Het
Zfp395 A G 14: 65,386,541 N153S possibly damaging Het
Zfp395 A G 14: 65,393,207 D402G probably damaging Het
Zfp652 T C 11: 95,749,609 V120A probably damaging Het
Zp3r T C 1: 130,582,892 I364M probably damaging Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90059474 critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90620873 missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90643103 missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91088491 unclassified probably null
IGL02079:Nrxn1 APN 17 90643083 missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91088401 missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90643243 missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90630083 missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90037258 missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 90704208 missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90208383 missense probably damaging 1.00
PIT4449001:Nrxn1 UTSW 17 90597579 missense probably damaging 1.00
PIT4791001:Nrxn1 UTSW 17 90455503 intron probably benign
R0123:Nrxn1 UTSW 17 90995487 splice site probably null
R0212:Nrxn1 UTSW 17 90362758 unclassified probably benign
R0277:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0323:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90208347 missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91088314 missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90565373 missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90362857 missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91088689 missense unknown
R0633:Nrxn1 UTSW 17 90704181 missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90037330 missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90643294 missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90162289 missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90208417 missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90037187 missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90162404 missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90588824 missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91088318 missense probably benign 0.01
R2116:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90162431 missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90597519 nonsense probably null
R3409:Nrxn1 UTSW 17 90208367 missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90623452 missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90623471 missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90208421 missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 90701982 missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90560768 missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90623422 missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90037081 missense probably damaging 1.00
R4877:Nrxn1 UTSW 17 91088177 missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90620846 intron probably benign
R5204:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 90704109 missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90535441 intron probably benign
R5473:Nrxn1 UTSW 17 90590092 missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90590032 missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90643224 missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 90704318 nonsense probably null
R5961:Nrxn1 UTSW 17 90454943 missense probably damaging 0.99
R5979:Nrxn1 UTSW 17 91088203 missense possibly damaging 0.54
R5992:Nrxn1 UTSW 17 90623507 missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90590098 missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6185:Nrxn1 UTSW 17 90037136 missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91088476 missense probably benign 0.14
R6306:Nrxn1 UTSW 17 90565446 missense possibly damaging 0.55
R6621:Nrxn1 UTSW 17 90162182 missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90059563 missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90037179 missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90629950 missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91088233 missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91088764 start gained probably benign
R7374:Nrxn1 UTSW 17 90588669 critical splice donor site probably null
R7564:Nrxn1 UTSW 17 90362906 missense possibly damaging 0.64
R7570:Nrxn1 UTSW 17 90162379 missense probably benign 0.35
X0021:Nrxn1 UTSW 17 90590212 missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90362831 missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90059505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGGCACTGAATGATGCTTGC -3'
(R):5'- GTACTGTTGTAGGGCACTGC -3'

Sequencing Primer
(F):5'- GCTGCTGCCATGGAAATG -3'
(R):5'- TTGTAGGGCACTGCAGACTC -3'
Posted On2016-02-04