Mutagenetix > Incidental Mutation

Incidental Mutation 'R4791:Cr2'

368533

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

041976-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R4791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 195155935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 698 (C698S)

Ref Sequence

ENSEMBL: ENSMUSP00000080938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: C698S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: C698S

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192604

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: C401S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: C401S

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193436

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: C698S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: C698S

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195737

Predicted Effect

unknown
Transcript: ENSMUST00000210219
AA Change: C1074S

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	G	T	6: 50,595,837	P32Q	probably damaging	Het
Abcc6	C	T	7: 45,982,160	V1231M	probably benign	Het
Agl	A	G	3: 116,786,528		probably null	Het
Ak7	T	C	12: 105,710,145	F35L	probably benign	Het
Aldh1a1	A	G	19: 20,619,985	N110S	probably damaging	Het
Arhgef5	C	T	6: 43,283,183	L1368F	probably damaging	Het
Atp5j2	T	C	5: 145,184,555	Y72C	possibly damaging	Het
Atp6v0a2	T	G	5: 124,646,727	F317V	probably benign	Het
Bank1	A	T	3: 136,254,929	S56T	probably benign	Het
BC080695	A	G	4: 143,570,989		probably benign	Het
Cachd1	T	A	4: 100,918,085	C166S	probably damaging	Het
Cand1	A	G	10: 119,210,702	I961T	probably benign	Het
Ccdc73	G	A	2: 104,981,105		probably null	Het
Cct6b	A	T	11: 82,742,004		probably null	Het
Chd2	A	C	7: 73,468,577	S1098A	probably benign	Het
Col6a4	A	T	9: 106,080,202	V141E	possibly damaging	Het
Col6a5	T	C	9: 105,930,784	T1022A	unknown	Het
Diexf	G	A	1: 193,128,267	H143Y	probably benign	Het
Dnaaf5	C	A	5: 139,184,650	Q786K	possibly damaging	Het
Dnah6	T	C	6: 73,095,074	D2423G	probably benign	Het
Dnhd1	T	C	7: 105,721,117	F4583S	probably damaging	Het
Duoxa2	A	T	2: 122,301,198	T123S	probably damaging	Het
Edem1	T	G	6: 108,841,634	V201G	probably damaging	Het
Eef1d	C	T	15: 75,903,682	A43T	possibly damaging	Het
Elavl3	T	C	9: 22,024,678	K249E	probably damaging	Het
Epg5	G	T	18: 77,948,996	E303*	probably null	Het
Fam83h	T	C	15: 76,002,368	D1040G	probably damaging	Het
Fndc7	A	T	3: 108,876,659	F211L	probably benign	Het
Fsip2	A	G	2: 82,982,108	T2924A	possibly damaging	Het
Gm5616	T	C	9: 48,450,683		noncoding transcript	Het
Gpr135	T	A	12: 72,069,868	D375V	probably benign	Het
Hgd	A	G	16: 37,631,825	*446W	probably null	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Htra2	A	G	6: 83,051,817	L379P	probably damaging	Het
Hypk	G	T	2: 121,457,655		probably null	Het
Ica1l	A	G	1: 60,010,201	F198L	probably damaging	Het
Igsf11	G	A	16: 39,024,864	S319N	probably damaging	Het
Il12rb1	T	C	8: 70,813,368	S213P	possibly damaging	Het
Katnal1	C	T	5: 148,904,650	V135M	probably damaging	Het
Kcnc4	G	A	3: 107,447,543	P530S	probably benign	Het
Kcnu1	T	C	8: 25,913,752	Y24H	probably damaging	Het
Kdm5b	A	G	1: 134,630,800	E1515G	possibly damaging	Het
Kif18a	A	T	2: 109,287,875	M12L	probably benign	Het
Klre1	T	C	6: 129,584,155	S160P	probably damaging	Het
Lama2	A	T	10: 27,467,271	H68Q	probably damaging	Het
Lgals8	T	C	13: 12,453,322	K49R	possibly damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Lsr	T	C	7: 30,958,552	T328A	probably damaging	Het
Mark4	C	T	7: 19,451,657	E51K	probably benign	Het
Mindy2	T	C	9: 70,634,001		probably null	Het
Mkks	G	A	2: 136,876,162	T400I	probably benign	Het
Mon2	T	A	10: 123,006,057	M1544L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Myo5c	T	G	9: 75,290,916	L1341R	probably damaging	Het
Nin	T	C	12: 70,043,807	R945G	possibly damaging	Het
Nox4	T	C	7: 87,304,847	V120A	probably benign	Het
Olfr1196	C	T	2: 88,700,898	V144I	probably benign	Het
Olfr1496	T	A	19: 13,781,342	C243*	probably null	Het
Olfr169	G	T	16: 19,566,663	H73Q	possibly damaging	Het
Olfr30	A	T	11: 58,455,544	V135E	possibly damaging	Het
Olfr847	T	C	9: 19,375,809	E24G	probably benign	Het
Plekha2	T	A	8: 25,042,762	R398W	probably damaging	Het
Pradc1	A	G	6: 85,447,191	W58R	probably damaging	Het
Prrc2b	A	G	2: 32,217,339		probably null	Het
Psg19	T	A	7: 18,794,146	N224I	probably damaging	Het
Ranbp17	A	C	11: 33,487,746	V164G	probably benign	Het
Rasgrp3	A	G	17: 75,500,173	S211G	probably benign	Het
Rcc1l	G	A	5: 134,163,776	P270S	possibly damaging	Het
Rfx6	T	A	10: 51,719,944		probably null	Het
Rnf222	A	T	11: 68,893,019	E137D	probably damaging	Het
Selenof	T	G	3: 144,596,823	Y120D	probably damaging	Het
Sema3b	G	T	9: 107,603,813	D108E	probably damaging	Het
Shank3	T	A	15: 89,500,354	L143Q	probably damaging	Het
Shtn1	G	C	19: 59,050,873	R45G	probably damaging	Het
Sirt4	T	C	5: 115,480,314	T234A	possibly damaging	Het
Slc25a30	C	A	14: 75,763,366	W266L	probably benign	Het
Spata20	A	T	11: 94,484,586	N127K	probably damaging	Het
St14	C	T	9: 31,095,622	G636D	probably benign	Het
Stat5a	G	A	11: 100,865,463	E170K	probably damaging	Het
Sugp2	C	T	8: 70,242,790	R138C	probably damaging	Het
Sult1e1	C	A	5: 87,586,730	W119L	possibly damaging	Het
Sv2a	T	C	3: 96,192,558	V608A	possibly damaging	Het
Syne2	T	C	12: 75,909,244	Y575H	possibly damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Thoc6	T	C	17: 23,670,067	H151R	possibly damaging	Het
Tm9sf2	T	C	14: 122,139,650	S197P	probably benign	Het
Tmem260	CAGGGACCGGCATAG	CAG	14: 48,511,994		probably benign	Het
Tmx2	G	A	2: 84,677,996	P15L	probably damaging	Het
Top1mt	C	T	15: 75,668,625		probably null	Het
Trpm6	T	A	19: 18,867,981	S1682T	probably benign	Het
Trrap	C	T	5: 144,803,277	R1171W	probably damaging	Het
Ugt3a2	A	G	15: 9,361,579	D147G	probably damaging	Het
Vnn3	A	G	10: 23,864,621	H274R	probably benign	Het
Vwf	C	A	6: 125,643,363	T1668K		Het
Zfp568	T	C	7: 30,015,183	S162P	probably damaging	Het
Zfp658	T	A	7: 43,574,466	C722S	possibly damaging	Het
Zfp808	T	A	13: 62,171,231	H91Q	probably damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TGGAAACTAGAGCATGCTTTCGG -3'
(R):5'- ACAGGGGAAGGGCTTTTATG -3'

Sequencing Primer
(F):5'- CTAGAGCATGCTTTCGGTTAAATAAC -3'
(R):5'- GAAGGGCTTTTATGAGTGCTTC -3'

Posted On

2016-02-04