Incidental Mutation 'R4791:Cr2'
ID 368533
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 041976-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R4791 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 194838243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 698 (C698S)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: C698S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: C698S

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192604
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: C401S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: C401S

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: C698S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: C698S

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195737
Predicted Effect unknown
Transcript: ENSMUST00000210219
AA Change: C1074S
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 C T 7: 45,631,584 (GRCm39) V1231M probably benign Het
Agl A G 3: 116,580,177 (GRCm39) probably null Het
Ak7 T C 12: 105,676,404 (GRCm39) F35L probably benign Het
Aldh1a1 A G 19: 20,597,349 (GRCm39) N110S probably damaging Het
Arhgef5 C T 6: 43,260,117 (GRCm39) L1368F probably damaging Het
Atp5mf T C 5: 145,121,365 (GRCm39) Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,784,667 (GRCm39) F317V probably benign Het
Bank1 A T 3: 135,960,690 (GRCm39) S56T probably benign Het
Cachd1 T A 4: 100,775,282 (GRCm39) C166S probably damaging Het
Cand1 A G 10: 119,046,607 (GRCm39) I961T probably benign Het
Ccdc73 G A 2: 104,811,450 (GRCm39) probably null Het
Cct6b A T 11: 82,632,830 (GRCm39) probably null Het
Chd2 A C 7: 73,118,325 (GRCm39) S1098A probably benign Het
Col6a4 A T 9: 105,957,401 (GRCm39) V141E possibly damaging Het
Col6a5 T C 9: 105,807,983 (GRCm39) T1022A unknown Het
Dnaaf5 C A 5: 139,170,405 (GRCm39) Q786K possibly damaging Het
Dnah6 T C 6: 73,072,057 (GRCm39) D2423G probably benign Het
Dnhd1 T C 7: 105,370,324 (GRCm39) F4583S probably damaging Het
Duoxa2 A T 2: 122,131,679 (GRCm39) T123S probably damaging Het
Edem1 T G 6: 108,818,595 (GRCm39) V201G probably damaging Het
Eef1d C T 15: 75,775,531 (GRCm39) A43T possibly damaging Het
Elavl3 T C 9: 21,935,974 (GRCm39) K249E probably damaging Het
Epg5 G T 18: 77,992,211 (GRCm39) E303* probably null Het
Fam83h T C 15: 75,874,217 (GRCm39) D1040G probably damaging Het
Fndc7 A T 3: 108,783,975 (GRCm39) F211L probably benign Het
Fsip2 A G 2: 82,812,452 (GRCm39) T2924A possibly damaging Het
Gm5616 T C 9: 48,361,983 (GRCm39) noncoding transcript Het
Gpr135 T A 12: 72,116,642 (GRCm39) D375V probably benign Het
Hgd A G 16: 37,452,187 (GRCm39) *446W probably null Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Htra2 A G 6: 83,028,798 (GRCm39) L379P probably damaging Het
Hypk G T 2: 121,288,136 (GRCm39) probably null Het
Ica1l A G 1: 60,049,360 (GRCm39) F198L probably damaging Het
Igsf11 G A 16: 38,845,226 (GRCm39) S319N probably damaging Het
Il12rb1 T C 8: 71,266,012 (GRCm39) S213P possibly damaging Het
Katnal1 C T 5: 148,841,460 (GRCm39) V135M probably damaging Het
Kcnc4 G A 3: 107,354,859 (GRCm39) P530S probably benign Het
Kcnu1 T C 8: 26,403,780 (GRCm39) Y24H probably damaging Het
Kdm5b A G 1: 134,558,538 (GRCm39) E1515G possibly damaging Het
Kif18a A T 2: 109,118,220 (GRCm39) M12L probably benign Het
Klre1 T C 6: 129,561,118 (GRCm39) S160P probably damaging Het
Lama2 A T 10: 27,343,267 (GRCm39) H68Q probably damaging Het
Lgals8 T C 13: 12,468,203 (GRCm39) K49R possibly damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Lsr T C 7: 30,657,977 (GRCm39) T328A probably damaging Het
Mark4 C T 7: 19,185,582 (GRCm39) E51K probably benign Het
Mindy2 T C 9: 70,541,283 (GRCm39) probably null Het
Mkks G A 2: 136,718,082 (GRCm39) T400I probably benign Het
Mon2 T A 10: 122,841,962 (GRCm39) M1544L probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Myo5c T G 9: 75,198,198 (GRCm39) L1341R probably damaging Het
Nin T C 12: 70,090,581 (GRCm39) R945G possibly damaging Het
Nox4 T C 7: 86,954,055 (GRCm39) V120A probably benign Het
Or1s2 T A 19: 13,758,706 (GRCm39) C243* probably null Het
Or2aj4 G T 16: 19,385,413 (GRCm39) H73Q possibly damaging Het
Or2z2 A T 11: 58,346,370 (GRCm39) V135E possibly damaging Het
Or4a66 C T 2: 88,531,242 (GRCm39) V144I probably benign Het
Or7g29 T C 9: 19,287,105 (GRCm39) E24G probably benign Het
Plekha2 T A 8: 25,532,778 (GRCm39) R398W probably damaging Het
Pradc1 A G 6: 85,424,173 (GRCm39) W58R probably damaging Het
Pramel20 A G 4: 143,297,559 (GRCm39) probably benign Het
Prrc2b A G 2: 32,107,351 (GRCm39) probably null Het
Psg19 T A 7: 18,528,071 (GRCm39) N224I probably damaging Het
Ranbp17 A C 11: 33,437,746 (GRCm39) V164G probably benign Het
Rasgrp3 A G 17: 75,807,168 (GRCm39) S211G probably benign Het
Rcc1l G A 5: 134,192,615 (GRCm39) P270S possibly damaging Het
Rfx6 T A 10: 51,596,040 (GRCm39) probably null Het
Rnf222 A T 11: 68,783,845 (GRCm39) E137D probably damaging Het
Selenof T G 3: 144,302,584 (GRCm39) Y120D probably damaging Het
Sema3b G T 9: 107,481,012 (GRCm39) D108E probably damaging Het
Shank3 T A 15: 89,384,557 (GRCm39) L143Q probably damaging Het
Shtn1 G C 19: 59,039,305 (GRCm39) R45G probably damaging Het
Sirt4 T C 5: 115,618,373 (GRCm39) T234A possibly damaging Het
Slc25a30 C A 14: 76,000,806 (GRCm39) W266L probably benign Het
Spata20 A T 11: 94,375,412 (GRCm39) N127K probably damaging Het
Spmip4 G T 6: 50,572,817 (GRCm39) P32Q probably damaging Het
St14 C T 9: 31,006,918 (GRCm39) G636D probably benign Het
Stat5a G A 11: 100,756,289 (GRCm39) E170K probably damaging Het
Sugp2 C T 8: 70,695,440 (GRCm39) R138C probably damaging Het
Sult1e1 C A 5: 87,734,589 (GRCm39) W119L possibly damaging Het
Sv2a T C 3: 96,099,874 (GRCm39) V608A possibly damaging Het
Syne2 T C 12: 75,956,018 (GRCm39) Y575H possibly damaging Het
Taok2 G A 7: 126,467,304 (GRCm39) S167L possibly damaging Het
Thoc6 T C 17: 23,889,041 (GRCm39) H151R possibly damaging Het
Tm9sf2 T C 14: 122,377,062 (GRCm39) S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,749,451 (GRCm39) probably benign Het
Tmx2 G A 2: 84,508,340 (GRCm39) P15L probably damaging Het
Top1mt C T 15: 75,540,474 (GRCm39) probably null Het
Trpm6 T A 19: 18,845,345 (GRCm39) S1682T probably benign Het
Trrap C T 5: 144,740,087 (GRCm39) R1171W probably damaging Het
Ugt3a1 A G 15: 9,361,665 (GRCm39) D147G probably damaging Het
Utp25 G A 1: 192,810,575 (GRCm39) H143Y probably benign Het
Vnn3 A G 10: 23,740,519 (GRCm39) H274R probably benign Het
Vwf C A 6: 125,620,326 (GRCm39) T1668K Het
Zfp568 T C 7: 29,714,608 (GRCm39) S162P probably damaging Het
Zfp658 T A 7: 43,223,890 (GRCm39) C722S possibly damaging Het
Zfp808 T A 13: 62,319,045 (GRCm39) H91Q probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGGAAACTAGAGCATGCTTTCGG -3'
(R):5'- ACAGGGGAAGGGCTTTTATG -3'

Sequencing Primer
(F):5'- CTAGAGCATGCTTTCGGTTAAATAAC -3'
(R):5'- GAAGGGCTTTTATGAGTGCTTC -3'
Posted On 2016-02-04