Incidental Mutation 'R4791:Atp6v0a2'
ID 368555
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s
MMRRC Submission 041976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock # R4791 (G1)
Quality Score 159
Status Not validated
Chromosome 5
Chromosomal Location 124628576-124724455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 124646727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 317 (F317V)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
AlphaFold P15920
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000037865
AA Change: F317V

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: F317V

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124721777 missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124646028 missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124636105 missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124646014 missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124721785 missense probably benign
IGL02650:Atp6v0a2 APN 5 124712362 splice site probably benign
IGL02687:Atp6v0a2 APN 5 124714142 missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124629202 missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124712781 missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124714107 splice site probably benign
IGL03198:Atp6v0a2 APN 5 124712361 critical splice donor site probably null
alkaline UTSW 5 124719866 missense probably damaging 1.00
basic UTSW 5 124712328 nonsense probably null
electronegative UTSW 5 124646698 missense probably damaging 1.00
energizer UTSW 5 124719986 missense probably damaging 0.98
Everready UTSW 5 124641505 missense probably damaging 0.99
Lithium UTSW 5 124714145 missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124713184 missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124717982 missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124646698 missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124718488 missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124627144 unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124712796 missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124646734 missense probably damaging 1.00
R5219:Atp6v0a2 UTSW 5 124713185 missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124713177 missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124646709 missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124645969 nonsense probably null
R5830:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124716327 missense probably benign
R5903:Atp6v0a2 UTSW 5 124712279 missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124629203 missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124713130 missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124641514 missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124712161 splice site probably null
R6994:Atp6v0a2 UTSW 5 124714145 missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124645983 missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124719866 missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124646736 missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124712328 nonsense probably null
R7714:Atp6v0a2 UTSW 5 124637595 missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124714198 missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124716496 missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124645031 missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R7977:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R7987:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124712773 missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124719088 missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124716470 missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124646649 missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124719997 missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124719074 missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124712248 missense probably damaging 0.98
R9360:Atp6v0a2 UTSW 5 124629194 missense possibly damaging 0.77
R9601:Atp6v0a2 UTSW 5 124713193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATTTGTGGCCTTGCTG -3'
(R):5'- TGAGACAAGGCCTCAAACTG -3'

Sequencing Primer
(F):5'- TGCGGTGGCAGAGAACTGTG -3'
(R):5'- TCAAACTGACCTCCAGCTCTC -3'
Posted On 2016-02-04