Incidental Mutation 'R4791:Arhgef5'
ID 368561
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 041976-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4791 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43260117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1368 (L1368F)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: L1368F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: L1368F

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182752
Predicted Effect unknown
Transcript: ENSMUST00000182924
AA Change: L636F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 C T 7: 45,631,584 (GRCm39) V1231M probably benign Het
Agl A G 3: 116,580,177 (GRCm39) probably null Het
Ak7 T C 12: 105,676,404 (GRCm39) F35L probably benign Het
Aldh1a1 A G 19: 20,597,349 (GRCm39) N110S probably damaging Het
Atp5mf T C 5: 145,121,365 (GRCm39) Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,784,667 (GRCm39) F317V probably benign Het
Bank1 A T 3: 135,960,690 (GRCm39) S56T probably benign Het
Cachd1 T A 4: 100,775,282 (GRCm39) C166S probably damaging Het
Cand1 A G 10: 119,046,607 (GRCm39) I961T probably benign Het
Ccdc73 G A 2: 104,811,450 (GRCm39) probably null Het
Cct6b A T 11: 82,632,830 (GRCm39) probably null Het
Chd2 A C 7: 73,118,325 (GRCm39) S1098A probably benign Het
Col6a4 A T 9: 105,957,401 (GRCm39) V141E possibly damaging Het
Col6a5 T C 9: 105,807,983 (GRCm39) T1022A unknown Het
Cr2 A T 1: 194,838,243 (GRCm39) C698S probably damaging Het
Dnaaf5 C A 5: 139,170,405 (GRCm39) Q786K possibly damaging Het
Dnah6 T C 6: 73,072,057 (GRCm39) D2423G probably benign Het
Dnhd1 T C 7: 105,370,324 (GRCm39) F4583S probably damaging Het
Duoxa2 A T 2: 122,131,679 (GRCm39) T123S probably damaging Het
Edem1 T G 6: 108,818,595 (GRCm39) V201G probably damaging Het
Eef1d C T 15: 75,775,531 (GRCm39) A43T possibly damaging Het
Elavl3 T C 9: 21,935,974 (GRCm39) K249E probably damaging Het
Epg5 G T 18: 77,992,211 (GRCm39) E303* probably null Het
Fam83h T C 15: 75,874,217 (GRCm39) D1040G probably damaging Het
Fndc7 A T 3: 108,783,975 (GRCm39) F211L probably benign Het
Fsip2 A G 2: 82,812,452 (GRCm39) T2924A possibly damaging Het
Gm5616 T C 9: 48,361,983 (GRCm39) noncoding transcript Het
Gpr135 T A 12: 72,116,642 (GRCm39) D375V probably benign Het
Hgd A G 16: 37,452,187 (GRCm39) *446W probably null Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Htra2 A G 6: 83,028,798 (GRCm39) L379P probably damaging Het
Hypk G T 2: 121,288,136 (GRCm39) probably null Het
Ica1l A G 1: 60,049,360 (GRCm39) F198L probably damaging Het
Igsf11 G A 16: 38,845,226 (GRCm39) S319N probably damaging Het
Il12rb1 T C 8: 71,266,012 (GRCm39) S213P possibly damaging Het
Katnal1 C T 5: 148,841,460 (GRCm39) V135M probably damaging Het
Kcnc4 G A 3: 107,354,859 (GRCm39) P530S probably benign Het
Kcnu1 T C 8: 26,403,780 (GRCm39) Y24H probably damaging Het
Kdm5b A G 1: 134,558,538 (GRCm39) E1515G possibly damaging Het
Kif18a A T 2: 109,118,220 (GRCm39) M12L probably benign Het
Klre1 T C 6: 129,561,118 (GRCm39) S160P probably damaging Het
Lama2 A T 10: 27,343,267 (GRCm39) H68Q probably damaging Het
Lgals8 T C 13: 12,468,203 (GRCm39) K49R possibly damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Lsr T C 7: 30,657,977 (GRCm39) T328A probably damaging Het
Mark4 C T 7: 19,185,582 (GRCm39) E51K probably benign Het
Mindy2 T C 9: 70,541,283 (GRCm39) probably null Het
Mkks G A 2: 136,718,082 (GRCm39) T400I probably benign Het
Mon2 T A 10: 122,841,962 (GRCm39) M1544L probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Myo5c T G 9: 75,198,198 (GRCm39) L1341R probably damaging Het
Nin T C 12: 70,090,581 (GRCm39) R945G possibly damaging Het
Nox4 T C 7: 86,954,055 (GRCm39) V120A probably benign Het
Or1s2 T A 19: 13,758,706 (GRCm39) C243* probably null Het
Or2aj4 G T 16: 19,385,413 (GRCm39) H73Q possibly damaging Het
Or2z2 A T 11: 58,346,370 (GRCm39) V135E possibly damaging Het
Or4a66 C T 2: 88,531,242 (GRCm39) V144I probably benign Het
Or7g29 T C 9: 19,287,105 (GRCm39) E24G probably benign Het
Plekha2 T A 8: 25,532,778 (GRCm39) R398W probably damaging Het
Pradc1 A G 6: 85,424,173 (GRCm39) W58R probably damaging Het
Pramel20 A G 4: 143,297,559 (GRCm39) probably benign Het
Prrc2b A G 2: 32,107,351 (GRCm39) probably null Het
Psg19 T A 7: 18,528,071 (GRCm39) N224I probably damaging Het
Ranbp17 A C 11: 33,437,746 (GRCm39) V164G probably benign Het
Rasgrp3 A G 17: 75,807,168 (GRCm39) S211G probably benign Het
Rcc1l G A 5: 134,192,615 (GRCm39) P270S possibly damaging Het
Rfx6 T A 10: 51,596,040 (GRCm39) probably null Het
Rnf222 A T 11: 68,783,845 (GRCm39) E137D probably damaging Het
Selenof T G 3: 144,302,584 (GRCm39) Y120D probably damaging Het
Sema3b G T 9: 107,481,012 (GRCm39) D108E probably damaging Het
Shank3 T A 15: 89,384,557 (GRCm39) L143Q probably damaging Het
Shtn1 G C 19: 59,039,305 (GRCm39) R45G probably damaging Het
Sirt4 T C 5: 115,618,373 (GRCm39) T234A possibly damaging Het
Slc25a30 C A 14: 76,000,806 (GRCm39) W266L probably benign Het
Spata20 A T 11: 94,375,412 (GRCm39) N127K probably damaging Het
Spmip4 G T 6: 50,572,817 (GRCm39) P32Q probably damaging Het
St14 C T 9: 31,006,918 (GRCm39) G636D probably benign Het
Stat5a G A 11: 100,756,289 (GRCm39) E170K probably damaging Het
Sugp2 C T 8: 70,695,440 (GRCm39) R138C probably damaging Het
Sult1e1 C A 5: 87,734,589 (GRCm39) W119L possibly damaging Het
Sv2a T C 3: 96,099,874 (GRCm39) V608A possibly damaging Het
Syne2 T C 12: 75,956,018 (GRCm39) Y575H possibly damaging Het
Taok2 G A 7: 126,467,304 (GRCm39) S167L possibly damaging Het
Thoc6 T C 17: 23,889,041 (GRCm39) H151R possibly damaging Het
Tm9sf2 T C 14: 122,377,062 (GRCm39) S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,749,451 (GRCm39) probably benign Het
Tmx2 G A 2: 84,508,340 (GRCm39) P15L probably damaging Het
Top1mt C T 15: 75,540,474 (GRCm39) probably null Het
Trpm6 T A 19: 18,845,345 (GRCm39) S1682T probably benign Het
Trrap C T 5: 144,740,087 (GRCm39) R1171W probably damaging Het
Ugt3a1 A G 15: 9,361,665 (GRCm39) D147G probably damaging Het
Utp25 G A 1: 192,810,575 (GRCm39) H143Y probably benign Het
Vnn3 A G 10: 23,740,519 (GRCm39) H274R probably benign Het
Vwf C A 6: 125,620,326 (GRCm39) T1668K Het
Zfp568 T C 7: 29,714,608 (GRCm39) S162P probably damaging Het
Zfp658 T A 7: 43,223,890 (GRCm39) C722S possibly damaging Het
Zfp808 T A 13: 62,319,045 (GRCm39) H91Q probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAACAATCTGGATGGCTTGATTTG -3'
(R):5'- TCCCATTCCAGCCACTGA -3'

Sequencing Primer
(F):5'- CTCTCAGGAGACAGTTATATCAGGC -3'
(R):5'- ATTCCAGCCACTGACTCTCGG -3'
Posted On 2016-02-04