Mutagenetix > Incidental Mutation

Incidental Mutation 'R4791:Arhgef5'

368561

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

041976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43283183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1368 (L1368F)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: L1368F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: L1368F

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: L636F

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	G	T	6: 50,595,837	P32Q	probably damaging	Het
Abcc6	C	T	7: 45,982,160	V1231M	probably benign	Het
Agl	A	G	3: 116,786,528		probably null	Het
Ak7	T	C	12: 105,710,145	F35L	probably benign	Het
Aldh1a1	A	G	19: 20,619,985	N110S	probably damaging	Het
Atp5j2	T	C	5: 145,184,555	Y72C	possibly damaging	Het
Atp6v0a2	T	G	5: 124,646,727	F317V	probably benign	Het
Bank1	A	T	3: 136,254,929	S56T	probably benign	Het
BC080695	A	G	4: 143,570,989		probably benign	Het
Cachd1	T	A	4: 100,918,085	C166S	probably damaging	Het
Cand1	A	G	10: 119,210,702	I961T	probably benign	Het
Ccdc73	G	A	2: 104,981,105		probably null	Het
Cct6b	A	T	11: 82,742,004		probably null	Het
Chd2	A	C	7: 73,468,577	S1098A	probably benign	Het
Col6a4	A	T	9: 106,080,202	V141E	possibly damaging	Het
Col6a5	T	C	9: 105,930,784	T1022A	unknown	Het
Cr2	A	T	1: 195,155,935	C698S	probably damaging	Het
Diexf	G	A	1: 193,128,267	H143Y	probably benign	Het
Dnaaf5	C	A	5: 139,184,650	Q786K	possibly damaging	Het
Dnah6	T	C	6: 73,095,074	D2423G	probably benign	Het
Dnhd1	T	C	7: 105,721,117	F4583S	probably damaging	Het
Duoxa2	A	T	2: 122,301,198	T123S	probably damaging	Het
Edem1	T	G	6: 108,841,634	V201G	probably damaging	Het
Eef1d	C	T	15: 75,903,682	A43T	possibly damaging	Het
Elavl3	T	C	9: 22,024,678	K249E	probably damaging	Het
Epg5	G	T	18: 77,948,996	E303*	probably null	Het
Fam83h	T	C	15: 76,002,368	D1040G	probably damaging	Het
Fndc7	A	T	3: 108,876,659	F211L	probably benign	Het
Fsip2	A	G	2: 82,982,108	T2924A	possibly damaging	Het
Gm5616	T	C	9: 48,450,683		noncoding transcript	Het
Gpr135	T	A	12: 72,069,868	D375V	probably benign	Het
Hgd	A	G	16: 37,631,825	*446W	probably null	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Htra2	A	G	6: 83,051,817	L379P	probably damaging	Het
Hypk	G	T	2: 121,457,655		probably null	Het
Ica1l	A	G	1: 60,010,201	F198L	probably damaging	Het
Igsf11	G	A	16: 39,024,864	S319N	probably damaging	Het
Il12rb1	T	C	8: 70,813,368	S213P	possibly damaging	Het
Katnal1	C	T	5: 148,904,650	V135M	probably damaging	Het
Kcnc4	G	A	3: 107,447,543	P530S	probably benign	Het
Kcnu1	T	C	8: 25,913,752	Y24H	probably damaging	Het
Kdm5b	A	G	1: 134,630,800	E1515G	possibly damaging	Het
Kif18a	A	T	2: 109,287,875	M12L	probably benign	Het
Klre1	T	C	6: 129,584,155	S160P	probably damaging	Het
Lama2	A	T	10: 27,467,271	H68Q	probably damaging	Het
Lgals8	T	C	13: 12,453,322	K49R	possibly damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Lsr	T	C	7: 30,958,552	T328A	probably damaging	Het
Mark4	C	T	7: 19,451,657	E51K	probably benign	Het
Mindy2	T	C	9: 70,634,001		probably null	Het
Mkks	G	A	2: 136,876,162	T400I	probably benign	Het
Mon2	T	A	10: 123,006,057	M1544L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Myo5c	T	G	9: 75,290,916	L1341R	probably damaging	Het
Nin	T	C	12: 70,043,807	R945G	possibly damaging	Het
Nox4	T	C	7: 87,304,847	V120A	probably benign	Het
Olfr1196	C	T	2: 88,700,898	V144I	probably benign	Het
Olfr1496	T	A	19: 13,781,342	C243*	probably null	Het
Olfr169	G	T	16: 19,566,663	H73Q	possibly damaging	Het
Olfr30	A	T	11: 58,455,544	V135E	possibly damaging	Het
Olfr847	T	C	9: 19,375,809	E24G	probably benign	Het
Plekha2	T	A	8: 25,042,762	R398W	probably damaging	Het
Pradc1	A	G	6: 85,447,191	W58R	probably damaging	Het
Prrc2b	A	G	2: 32,217,339		probably null	Het
Psg19	T	A	7: 18,794,146	N224I	probably damaging	Het
Ranbp17	A	C	11: 33,487,746	V164G	probably benign	Het
Rasgrp3	A	G	17: 75,500,173	S211G	probably benign	Het
Rcc1l	G	A	5: 134,163,776	P270S	possibly damaging	Het
Rfx6	T	A	10: 51,719,944		probably null	Het
Rnf222	A	T	11: 68,893,019	E137D	probably damaging	Het
Selenof	T	G	3: 144,596,823	Y120D	probably damaging	Het
Sema3b	G	T	9: 107,603,813	D108E	probably damaging	Het
Shank3	T	A	15: 89,500,354	L143Q	probably damaging	Het
Shtn1	G	C	19: 59,050,873	R45G	probably damaging	Het
Sirt4	T	C	5: 115,480,314	T234A	possibly damaging	Het
Slc25a30	C	A	14: 75,763,366	W266L	probably benign	Het
Spata20	A	T	11: 94,484,586	N127K	probably damaging	Het
St14	C	T	9: 31,095,622	G636D	probably benign	Het
Stat5a	G	A	11: 100,865,463	E170K	probably damaging	Het
Sugp2	C	T	8: 70,242,790	R138C	probably damaging	Het
Sult1e1	C	A	5: 87,586,730	W119L	possibly damaging	Het
Sv2a	T	C	3: 96,192,558	V608A	possibly damaging	Het
Syne2	T	C	12: 75,909,244	Y575H	possibly damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Thoc6	T	C	17: 23,670,067	H151R	possibly damaging	Het
Tm9sf2	T	C	14: 122,139,650	S197P	probably benign	Het
Tmem260	CAGGGACCGGCATAG	CAG	14: 48,511,994		probably benign	Het
Tmx2	G	A	2: 84,677,996	P15L	probably damaging	Het
Top1mt	C	T	15: 75,668,625		probably null	Het
Trpm6	T	A	19: 18,867,981	S1682T	probably benign	Het
Trrap	C	T	5: 144,803,277	R1171W	probably damaging	Het
Ugt3a2	A	G	15: 9,361,579	D147G	probably damaging	Het
Vnn3	A	G	10: 23,864,621	H274R	probably benign	Het
Vwf	C	A	6: 125,643,363	T1668K		Het
Zfp568	T	C	7: 30,015,183	S162P	probably damaging	Het
Zfp658	T	A	7: 43,574,466	C722S	possibly damaging	Het
Zfp808	T	A	13: 62,171,231	H91Q	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAACAATCTGGATGGCTTGATTTG -3'
(R):5'- TCCCATTCCAGCCACTGA -3'

Sequencing Primer
(F):5'- CTCTCAGGAGACAGTTATATCAGGC -3'
(R):5'- ATTCCAGCCACTGACTCTCGG -3'

Posted On

2016-02-04