Incidental Mutation 'R4791:Zfp568'
ID368572
Institutional Source Beutler Lab
Gene Symbol Zfp568
Ensembl Gene ENSMUSG00000074221
Gene Namezinc finger protein 568
Synonymschato, LOC381866
MMRRC Submission 041976-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4791 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29983955-30028282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30015183 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 162 (S162P)
Ref Sequence ENSEMBL: ENSMUSP00000118387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074322] [ENSMUST00000146074] [ENSMUST00000148442] [ENSMUST00000177931] [ENSMUST00000207940]
Predicted Effect probably damaging
Transcript: ENSMUST00000074322
AA Change: S162P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073930
Gene: ENSMUSG00000074221
AA Change: S162P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146074
AA Change: S161P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118823
Gene: ENSMUSG00000074221
AA Change: S161P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148442
AA Change: S162P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118387
Gene: ENSMUSG00000074221
AA Change: S162P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 124 184 2.01e-28 SMART
ZnF_C2H2 363 385 7.78e-3 SMART
ZnF_C2H2 391 413 3.95e-4 SMART
ZnF_C2H2 419 441 3.44e-4 SMART
ZnF_C2H2 447 469 2.2e-2 SMART
ZnF_C2H2 475 497 6.67e-2 SMART
ZnF_C2H2 503 525 6.32e-3 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
ZnF_C2H2 559 581 2.09e-3 SMART
ZnF_C2H2 587 609 2.95e-3 SMART
ZnF_C2H2 615 637 3.69e-4 SMART
ZnF_C2H2 643 665 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177931
AA Change: S161P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137438
Gene: ENSMUSG00000074221
AA Change: S161P

DomainStartEndE-ValueType
KRAB 34 94 2.73e-39 SMART
KRAB 123 183 2.01e-28 SMART
ZnF_C2H2 362 384 7.78e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
ZnF_C2H2 446 468 2.2e-2 SMART
ZnF_C2H2 474 496 6.67e-2 SMART
ZnF_C2H2 502 524 6.32e-3 SMART
ZnF_C2H2 530 552 4.87e-4 SMART
ZnF_C2H2 558 580 2.09e-3 SMART
ZnF_C2H2 586 608 2.95e-3 SMART
ZnF_C2H2 614 636 3.69e-4 SMART
ZnF_C2H2 642 664 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are embryonic lethal with growth arrest around E8.5-9.0. Mutant embryo shows shortened anterior-posterior axial extension with defects in somites and midline structures including open gut tube, cardia bifida, and failure to closeneural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Zfp568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zfp568 APN 7 30022440 missense possibly damaging 0.66
IGL00792:Zfp568 APN 7 30015072 missense probably benign 0.00
IGL01133:Zfp568 APN 7 29987808 critical splice donor site probably null
IGL01330:Zfp568 APN 7 30022277 missense probably benign 0.01
IGL03157:Zfp568 APN 7 30022764 missense probably damaging 1.00
R0739:Zfp568 UTSW 7 30023321 missense probably damaging 1.00
R1051:Zfp568 UTSW 7 30022529 nonsense probably null
R1967:Zfp568 UTSW 7 29989088 missense probably damaging 0.99
R2038:Zfp568 UTSW 7 29989082 missense probably null 1.00
R3874:Zfp568 UTSW 7 30023396 missense probably damaging 1.00
R4438:Zfp568 UTSW 7 30022296 missense probably benign
R4584:Zfp568 UTSW 7 29998192 missense probably benign 0.04
R4667:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4669:Zfp568 UTSW 7 30023277 missense probably damaging 1.00
R4773:Zfp568 UTSW 7 29997770 missense probably damaging 1.00
R5250:Zfp568 UTSW 7 30017230 missense probably benign 0.12
R5541:Zfp568 UTSW 7 30022876 missense possibly damaging 0.81
R5956:Zfp568 UTSW 7 29997863 missense probably damaging 1.00
R6444:Zfp568 UTSW 7 30017257 missense probably benign 0.01
R6600:Zfp568 UTSW 7 30022523 missense possibly damaging 0.71
R7299:Zfp568 UTSW 7 30017244 missense probably benign 0.34
R7316:Zfp568 UTSW 7 30022256 missense possibly damaging 0.95
R7562:Zfp568 UTSW 7 30023256 missense probably benign 0.04
R7664:Zfp568 UTSW 7 30022290 missense probably benign
R7672:Zfp568 UTSW 7 29997787 missense probably damaging 0.99
R7759:Zfp568 UTSW 7 30023414 missense possibly damaging 0.66
R7790:Zfp568 UTSW 7 30022725 missense probably damaging 1.00
R7811:Zfp568 UTSW 7 29997870 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAAGGCATGTTCAGAGCCC -3'
(R):5'- CCAGAGCTTGAAACGTGTTC -3'

Sequencing Primer
(F):5'- ATGTTCAGAGCCCGCATG -3'
(R):5'- AGTTTAAGGTCACCCTGAGC -3'
Posted On2016-02-04