Incidental Mutation 'R4791:Mrc2'
ID368608
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 041976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4791 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105348431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGAGCTGCCAGAGAAGAG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On2016-02-04