Mutagenetix > Incidental Mutations

Incidental Mutation 'R4791:Nin'

368609

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

041976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4791 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70043807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 945 (R945G)

Ref Sequence

ENSEMBL: ENSMUSP00000152240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021468
AA Change: R945G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: R945G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085314
AA Change: R945G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: R945G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095666
AA Change: R945G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: R945G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169074
AA Change: R945G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: R945G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222237
AA Change: R945G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000222835

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223257
AA Change: R945G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223316

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	G	T	6: 50,595,837	P32Q	probably damaging	Het
Abcc6	C	T	7: 45,982,160	V1231M	probably benign	Het
Agl	A	G	3: 116,786,528		probably null	Het
Ak7	T	C	12: 105,710,145	F35L	probably benign	Het
Aldh1a1	A	G	19: 20,619,985	N110S	probably damaging	Het
Arhgef5	C	T	6: 43,283,183	L1368F	probably damaging	Het
Atp5j2	T	C	5: 145,184,555	Y72C	possibly damaging	Het
Atp6v0a2	T	G	5: 124,646,727	F317V	probably benign	Het
Bank1	A	T	3: 136,254,929	S56T	probably benign	Het
BC080695	A	G	4: 143,570,989		probably benign	Het
Cachd1	T	A	4: 100,918,085	C166S	probably damaging	Het
Cand1	A	G	10: 119,210,702	I961T	probably benign	Het
Ccdc73	G	A	2: 104,981,105		probably null	Het
Cct6b	A	T	11: 82,742,004		probably null	Het
Chd2	A	C	7: 73,468,577	S1098A	probably benign	Het
Col6a4	A	T	9: 106,080,202	V141E	possibly damaging	Het
Col6a5	T	C	9: 105,930,784	T1022A	unknown	Het
Cr2	A	T	1: 195,155,935	C698S	probably damaging	Het
Diexf	G	A	1: 193,128,267	H143Y	probably benign	Het
Dnaaf5	C	A	5: 139,184,650	Q786K	possibly damaging	Het
Dnah6	T	C	6: 73,095,074	D2423G	probably benign	Het
Dnhd1	T	C	7: 105,721,117	F4583S	probably damaging	Het
Duoxa2	A	T	2: 122,301,198	T123S	probably damaging	Het
Edem1	T	G	6: 108,841,634	V201G	probably damaging	Het
Eef1d	C	T	15: 75,903,682	A43T	possibly damaging	Het
Elavl3	T	C	9: 22,024,678	K249E	probably damaging	Het
Epg5	G	T	18: 77,948,996	E303*	probably null	Het
Fam83h	T	C	15: 76,002,368	D1040G	probably damaging	Het
Fndc7	A	T	3: 108,876,659	F211L	probably benign	Het
Fsip2	A	G	2: 82,982,108	T2924A	possibly damaging	Het
Gm5616	T	C	9: 48,450,683		noncoding transcript	Het
Gpr135	T	A	12: 72,069,868	D375V	probably benign	Het
Hgd	A	G	16: 37,631,825	*446W	probably null	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Htra2	A	G	6: 83,051,817	L379P	probably damaging	Het
Hypk	G	T	2: 121,457,655		probably null	Het
Ica1l	A	G	1: 60,010,201	F198L	probably damaging	Het
Igsf11	G	A	16: 39,024,864	S319N	probably damaging	Het
Il12rb1	T	C	8: 70,813,368	S213P	possibly damaging	Het
Katnal1	C	T	5: 148,904,650	V135M	probably damaging	Het
Kcnc4	G	A	3: 107,447,543	P530S	probably benign	Het
Kcnu1	T	C	8: 25,913,752	Y24H	probably damaging	Het
Kdm5b	A	G	1: 134,630,800	E1515G	possibly damaging	Het
Kif18a	A	T	2: 109,287,875	M12L	probably benign	Het
Klre1	T	C	6: 129,584,155	S160P	probably damaging	Het
Lama2	A	T	10: 27,467,271	H68Q	probably damaging	Het
Lgals8	T	C	13: 12,453,322	K49R	possibly damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Lsr	T	C	7: 30,958,552	T328A	probably damaging	Het
Mark4	C	T	7: 19,451,657	E51K	probably benign	Het
Mindy2	T	C	9: 70,634,001		probably null	Het
Mkks	G	A	2: 136,876,162	T400I	probably benign	Het
Mon2	T	A	10: 123,006,057	M1544L	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Myo5c	T	G	9: 75,290,916	L1341R	probably damaging	Het
Nox4	T	C	7: 87,304,847	V120A	probably benign	Het
Olfr1196	C	T	2: 88,700,898	V144I	probably benign	Het
Olfr1496	T	A	19: 13,781,342	C243*	probably null	Het
Olfr169	G	T	16: 19,566,663	H73Q	possibly damaging	Het
Olfr30	A	T	11: 58,455,544	V135E	possibly damaging	Het
Olfr847	T	C	9: 19,375,809	E24G	probably benign	Het
Plekha2	T	A	8: 25,042,762	R398W	probably damaging	Het
Pradc1	A	G	6: 85,447,191	W58R	probably damaging	Het
Prrc2b	A	G	2: 32,217,339		probably null	Het
Psg19	T	A	7: 18,794,146	N224I	probably damaging	Het
Ranbp17	A	C	11: 33,487,746	V164G	probably benign	Het
Rasgrp3	A	G	17: 75,500,173	S211G	probably benign	Het
Rcc1l	G	A	5: 134,163,776	P270S	possibly damaging	Het
Rfx6	T	A	10: 51,719,944		probably null	Het
Rnf222	A	T	11: 68,893,019	E137D	probably damaging	Het
Selenof	T	G	3: 144,596,823	Y120D	probably damaging	Het
Sema3b	G	T	9: 107,603,813	D108E	probably damaging	Het
Shank3	T	A	15: 89,500,354	L143Q	probably damaging	Het
Shtn1	G	C	19: 59,050,873	R45G	probably damaging	Het
Sirt4	T	C	5: 115,480,314	T234A	possibly damaging	Het
Slc25a30	C	A	14: 75,763,366	W266L	probably benign	Het
Spata20	A	T	11: 94,484,586	N127K	probably damaging	Het
St14	C	T	9: 31,095,622	G636D	probably benign	Het
Stat5a	G	A	11: 100,865,463	E170K	probably damaging	Het
Sugp2	C	T	8: 70,242,790	R138C	probably damaging	Het
Sult1e1	C	A	5: 87,586,730	W119L	possibly damaging	Het
Sv2a	T	C	3: 96,192,558	V608A	possibly damaging	Het
Syne2	T	C	12: 75,909,244	Y575H	possibly damaging	Het
Taok2	G	A	7: 126,868,132	S167L	possibly damaging	Het
Thoc6	T	C	17: 23,670,067	H151R	possibly damaging	Het
Tm9sf2	T	C	14: 122,139,650	S197P	probably benign	Het
Tmem260	CAGGGACCGGCATAG	CAG	14: 48,511,994		probably benign	Het
Tmx2	G	A	2: 84,677,996	P15L	probably damaging	Het
Top1mt	C	T	15: 75,668,625		probably null	Het
Trpm6	T	A	19: 18,867,981	S1682T	probably benign	Het
Trrap	C	T	5: 144,803,277	R1171W	probably damaging	Het
Ugt3a2	A	G	15: 9,361,579	D147G	probably damaging	Het
Vnn3	A	G	10: 23,864,621	H274R	probably benign	Het
Vwf	C	A	6: 125,643,363	T1668K		Het
Zfp568	T	C	7: 30,015,183	S162P	probably damaging	Het
Zfp658	T	A	7: 43,574,466	C722S	possibly damaging	Het
Zfp808	T	A	13: 62,171,231	H91Q	probably damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- CACCCTGAAGCATCAAGAGA -3'
(R):5'- CGGCCATGAAGCAGGAACAG -3'

Sequencing Primer
(F):5'- ACTGTATTCTGAAGCCTGCAG -3'
(R):5'- CAGGAGATACTGGAGAGGACATAC -3'

Posted On

2016-02-04