Incidental Mutation 'R4791:Rasgrp3'
ID 368630
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene Name RAS, guanyl releasing protein 3
Synonyms LOC240168
MMRRC Submission 041976-MU
Accession Numbers

Ncbi RefSeq: NM_207246.4, NM_001166493.1; MGI:3028579

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4791 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 75435905-75529043 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75500173 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 211 (S211G)
Ref Sequence ENSEMBL: ENSMUSP00000129393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
AlphaFold Q6NZH9
Predicted Effect probably benign
Transcript: ENSMUST00000095204
AA Change: S211G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042
AA Change: S211G

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164192
AA Change: S211G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042
AA Change: S211G

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype Strain: 3625862; 3525522
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75516373 missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75525102 missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75496417 missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75497070 missense probably benign 0.00
Aster UTSW 17 75509827 splice site probably null
aston UTSW 17 75500758 critical splice donor site probably null
centre UTSW 17 75500734 missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75500713 missense probably damaging 1.00
PIT4243001:Rasgrp3 UTSW 17 75500139 missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75498461 missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75509827 splice site probably null
R1182:Rasgrp3 UTSW 17 75503190 missense probably benign 0.01
R1412:Rasgrp3 UTSW 17 75509827 splice site probably null
R1572:Rasgrp3 UTSW 17 75500734 missense possibly damaging 0.50
R1664:Rasgrp3 UTSW 17 75524177 missense probably damaging 1.00
R2094:Rasgrp3 UTSW 17 75503141 missense probably damaging 1.00
R2111:Rasgrp3 UTSW 17 75500758 critical splice donor site probably null
R3026:Rasgrp3 UTSW 17 75524921 missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75496968 missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75511980 missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75500673 missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75498448 missense possibly damaging 0.64
R4901:Rasgrp3 UTSW 17 75514116 nonsense probably null
R4927:Rasgrp3 UTSW 17 75516355 missense probably benign 0.00
R5410:Rasgrp3 UTSW 17 75497047 missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75503375 missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75525018 missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75516359 missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75524945 missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75503147 missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75494209 missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75503115 missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75503246 missense probably damaging 1.00
R7409:Rasgrp3 UTSW 17 75516416 missense possibly damaging 0.48
R7507:Rasgrp3 UTSW 17 75497060 missense probably damaging 1.00
R7536:Rasgrp3 UTSW 17 75514133 missense probably damaging 1.00
R7538:Rasgrp3 UTSW 17 75496416 missense probably benign
R8089:Rasgrp3 UTSW 17 75497061 missense possibly damaging 0.54
R8677:Rasgrp3 UTSW 17 75512060 missense probably benign 0.00
R9483:Rasgrp3 UTSW 17 75500722 missense probably benign 0.22
R9521:Rasgrp3 UTSW 17 75514163 missense probably null 1.00
R9557:Rasgrp3 UTSW 17 75500144 missense probably damaging 0.98
R9727:Rasgrp3 UTSW 17 75503244 missense probably damaging 1.00
R9757:Rasgrp3 UTSW 17 75500724 missense probably damaging 1.00
X0011:Rasgrp3 UTSW 17 75525166 nonsense probably null
Z1177:Rasgrp3 UTSW 17 75512095 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGTGCTACGAAAGGCTAG -3'
(R):5'- GAACAGTTTAATAGTCCAGTGCTG -3'

Sequencing Primer
(F):5'- TGCTACGAAAGGCTAGCTCATG -3'
(R):5'- AGTCCAGTGCTGTTTTATTGCTAAC -3'
Posted On 2016-02-04