Incidental Mutation 'R4791:Trpm6'
ID 368635
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 041976-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4791 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18749983-18892510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18867981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1682 (S1682T)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: S1682T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: S1682T

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 (GRCm38) P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 (GRCm38) V1231M probably benign Het
Agl A G 3: 116,786,528 (GRCm38) probably null Het
Ak7 T C 12: 105,710,145 (GRCm38) F35L probably benign Het
Aldh1a1 A G 19: 20,619,985 (GRCm38) N110S probably damaging Het
Arhgef5 C T 6: 43,283,183 (GRCm38) L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 (GRCm38) Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 (GRCm38) F317V probably benign Het
Bank1 A T 3: 136,254,929 (GRCm38) S56T probably benign Het
BC080695 A G 4: 143,570,989 (GRCm38) probably benign Het
Cachd1 T A 4: 100,918,085 (GRCm38) C166S probably damaging Het
Cand1 A G 10: 119,210,702 (GRCm38) I961T probably benign Het
Ccdc73 G A 2: 104,981,105 (GRCm38) probably null Het
Cct6b A T 11: 82,742,004 (GRCm38) probably null Het
Chd2 A C 7: 73,468,577 (GRCm38) S1098A probably benign Het
Col6a4 A T 9: 106,080,202 (GRCm38) V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 (GRCm38) T1022A unknown Het
Cr2 A T 1: 195,155,935 (GRCm38) C698S probably damaging Het
Diexf G A 1: 193,128,267 (GRCm38) H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 (GRCm38) Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 (GRCm38) D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 (GRCm38) F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 (GRCm38) T123S probably damaging Het
Edem1 T G 6: 108,841,634 (GRCm38) V201G probably damaging Het
Eef1d C T 15: 75,903,682 (GRCm38) A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 (GRCm38) K249E probably damaging Het
Epg5 G T 18: 77,948,996 (GRCm38) E303* probably null Het
Fam83h T C 15: 76,002,368 (GRCm38) D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 (GRCm38) F211L probably benign Het
Fsip2 A G 2: 82,982,108 (GRCm38) T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 (GRCm38) noncoding transcript Het
Gpr135 T A 12: 72,069,868 (GRCm38) D375V probably benign Het
Hgd A G 16: 37,631,825 (GRCm38) *446W probably null Het
Hivep2 C A 10: 14,128,969 (GRCm38) T437K probably benign Het
Htra2 A G 6: 83,051,817 (GRCm38) L379P probably damaging Het
Hypk G T 2: 121,457,655 (GRCm38) probably null Het
Ica1l A G 1: 60,010,201 (GRCm38) F198L probably damaging Het
Igsf11 G A 16: 39,024,864 (GRCm38) S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 (GRCm38) S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 (GRCm38) V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 (GRCm38) P530S probably benign Het
Kcnu1 T C 8: 25,913,752 (GRCm38) Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 (GRCm38) E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 (GRCm38) M12L probably benign Het
Klre1 T C 6: 129,584,155 (GRCm38) S160P probably damaging Het
Lama2 A T 10: 27,467,271 (GRCm38) H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 (GRCm38) K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 (GRCm38) V317M probably damaging Het
Lsr T C 7: 30,958,552 (GRCm38) T328A probably damaging Het
Mark4 C T 7: 19,451,657 (GRCm38) E51K probably benign Het
Mindy2 T C 9: 70,634,001 (GRCm38) probably null Het
Mkks G A 2: 136,876,162 (GRCm38) T400I probably benign Het
Mon2 T A 10: 123,006,057 (GRCm38) M1544L probably benign Het
Mrc2 G A 11: 105,348,431 (GRCm38) probably null Het
Myo5c T G 9: 75,290,916 (GRCm38) L1341R probably damaging Het
Nin T C 12: 70,043,807 (GRCm38) R945G possibly damaging Het
Nox4 T C 7: 87,304,847 (GRCm38) V120A probably benign Het
Olfr1196 C T 2: 88,700,898 (GRCm38) V144I probably benign Het
Olfr1496 T A 19: 13,781,342 (GRCm38) C243* probably null Het
Olfr169 G T 16: 19,566,663 (GRCm38) H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 (GRCm38) V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 (GRCm38) E24G probably benign Het
Plekha2 T A 8: 25,042,762 (GRCm38) R398W probably damaging Het
Pradc1 A G 6: 85,447,191 (GRCm38) W58R probably damaging Het
Prrc2b A G 2: 32,217,339 (GRCm38) probably null Het
Psg19 T A 7: 18,794,146 (GRCm38) N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 (GRCm38) V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 (GRCm38) S211G probably benign Het
Rcc1l G A 5: 134,163,776 (GRCm38) P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 (GRCm38) probably null Het
Rnf222 A T 11: 68,893,019 (GRCm38) E137D probably damaging Het
Selenof T G 3: 144,596,823 (GRCm38) Y120D probably damaging Het
Sema3b G T 9: 107,603,813 (GRCm38) D108E probably damaging Het
Shank3 T A 15: 89,500,354 (GRCm38) L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 (GRCm38) R45G probably damaging Het
Sirt4 T C 5: 115,480,314 (GRCm38) T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 (GRCm38) W266L probably benign Het
Spata20 A T 11: 94,484,586 (GRCm38) N127K probably damaging Het
St14 C T 9: 31,095,622 (GRCm38) G636D probably benign Het
Stat5a G A 11: 100,865,463 (GRCm38) E170K probably damaging Het
Sugp2 C T 8: 70,242,790 (GRCm38) R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 (GRCm38) W119L possibly damaging Het
Sv2a T C 3: 96,192,558 (GRCm38) V608A possibly damaging Het
Syne2 T C 12: 75,909,244 (GRCm38) Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 (GRCm38) S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 (GRCm38) H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 (GRCm38) S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 (GRCm38) probably benign Het
Tmx2 G A 2: 84,677,996 (GRCm38) P15L probably damaging Het
Top1mt C T 15: 75,668,625 (GRCm38) probably null Het
Trrap C T 5: 144,803,277 (GRCm38) R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 (GRCm38) D147G probably damaging Het
Vnn3 A G 10: 23,864,621 (GRCm38) H274R probably benign Het
Vwf C A 6: 125,643,363 (GRCm38) T1668K Het
Zfp568 T C 7: 30,015,183 (GRCm38) S162P probably damaging Het
Zfp658 T A 7: 43,574,466 (GRCm38) C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 (GRCm38) H91Q probably damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,783,908 (GRCm38) splice site probably benign
IGL00862:Trpm6 APN 19 18,827,528 (GRCm38) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,877,651 (GRCm38) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,825,794 (GRCm38) nonsense probably null
IGL01451:Trpm6 APN 19 18,809,569 (GRCm38) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,796,530 (GRCm38) nonsense probably null
IGL01995:Trpm6 APN 19 18,830,327 (GRCm38) splice site probably benign
IGL02092:Trpm6 APN 19 18,772,331 (GRCm38) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,832,539 (GRCm38) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,854,063 (GRCm38) missense probably benign
IGL02329:Trpm6 APN 19 18,854,217 (GRCm38) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,778,510 (GRCm38) splice site probably benign
IGL02402:Trpm6 APN 19 18,786,756 (GRCm38) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,827,398 (GRCm38) nonsense probably null
IGL02457:Trpm6 APN 19 18,825,791 (GRCm38) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,802,207 (GRCm38) splice site probably benign
IGL02705:Trpm6 APN 19 18,776,733 (GRCm38) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,809,652 (GRCm38) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,830,012 (GRCm38) splice site probably benign
IGL02818:Trpm6 APN 19 18,866,257 (GRCm38) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,813,482 (GRCm38) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,838,017 (GRCm38) nonsense probably null
IGL03193:Trpm6 APN 19 18,825,872 (GRCm38) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,786,779 (GRCm38) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,819,119 (GRCm38) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,819,181 (GRCm38) missense probably benign
IGL03245:Trpm6 APN 19 18,877,701 (GRCm38) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,838,082 (GRCm38) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,813,486 (GRCm38) missense probably benign
P0043:Trpm6 UTSW 19 18,877,765 (GRCm38) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,825,802 (GRCm38) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,786,755 (GRCm38) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,829,952 (GRCm38) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,832,593 (GRCm38) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,819,194 (GRCm38) splice site probably null
R0267:Trpm6 UTSW 19 18,823,378 (GRCm38) missense probably benign
R0350:Trpm6 UTSW 19 18,883,957 (GRCm38) splice site probably null
R0373:Trpm6 UTSW 19 18,853,587 (GRCm38) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,778,644 (GRCm38) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,783,025 (GRCm38) splice site probably benign
R0505:Trpm6 UTSW 19 18,873,902 (GRCm38) splice site probably benign
R0526:Trpm6 UTSW 19 18,792,876 (GRCm38) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,872,221 (GRCm38) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,825,862 (GRCm38) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,838,087 (GRCm38) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,796,498 (GRCm38) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,796,495 (GRCm38) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,875,931 (GRCm38) missense probably benign
R1558:Trpm6 UTSW 19 18,786,828 (GRCm38) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,827,524 (GRCm38) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,877,631 (GRCm38) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,856,217 (GRCm38) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,827,567 (GRCm38) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,891,999 (GRCm38) splice site probably null
R1840:Trpm6 UTSW 19 18,866,267 (GRCm38) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,796,284 (GRCm38) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,854,265 (GRCm38) missense probably benign
R2073:Trpm6 UTSW 19 18,876,042 (GRCm38) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,877,739 (GRCm38) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,825,752 (GRCm38) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,796,284 (GRCm38) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,813,350 (GRCm38) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,829,952 (GRCm38) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,792,090 (GRCm38) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,854,431 (GRCm38) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,772,393 (GRCm38) nonsense probably null
R3779:Trpm6 UTSW 19 18,876,039 (GRCm38) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,832,557 (GRCm38) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,827,525 (GRCm38) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,796,500 (GRCm38) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,832,477 (GRCm38) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,832,597 (GRCm38) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,825,872 (GRCm38) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,853,791 (GRCm38) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,854,200 (GRCm38) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,876,064 (GRCm38) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,813,493 (GRCm38) missense probably damaging 0.97
R4814:Trpm6 UTSW 19 18,862,212 (GRCm38) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,786,760 (GRCm38) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,813,464 (GRCm38) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,829,933 (GRCm38) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,830,207 (GRCm38) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,853,604 (GRCm38) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,853,617 (GRCm38) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,786,819 (GRCm38) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,856,175 (GRCm38) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,892,019 (GRCm38) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,853,748 (GRCm38) nonsense probably null
R6105:Trpm6 UTSW 19 18,853,748 (GRCm38) nonsense probably null
R6211:Trpm6 UTSW 19 18,783,128 (GRCm38) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,854,291 (GRCm38) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,854,108 (GRCm38) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,829,990 (GRCm38) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,838,042 (GRCm38) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,889,020 (GRCm38) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,796,439 (GRCm38) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,830,297 (GRCm38) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,877,765 (GRCm38) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,783,163 (GRCm38) missense probably benign
R7103:Trpm6 UTSW 19 18,813,547 (GRCm38) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,854,033 (GRCm38) nonsense probably null
R7128:Trpm6 UTSW 19 18,811,773 (GRCm38) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,838,098 (GRCm38) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,853,791 (GRCm38) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,876,786 (GRCm38) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,778,585 (GRCm38) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,876,091 (GRCm38) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,876,120 (GRCm38) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,778,665 (GRCm38) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,832,581 (GRCm38) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,867,961 (GRCm38) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,876,013 (GRCm38) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,854,249 (GRCm38) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,827,408 (GRCm38) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,750,045 (GRCm38) splice site probably null
R7807:Trpm6 UTSW 19 18,829,856 (GRCm38) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,815,241 (GRCm38) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,776,710 (GRCm38) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,854,290 (GRCm38) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,876,110 (GRCm38) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,778,659 (GRCm38) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,815,350 (GRCm38) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,792,862 (GRCm38) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,811,790 (GRCm38) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,873,861 (GRCm38) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,853,968 (GRCm38) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,832,485 (GRCm38) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,892,095 (GRCm38) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,838,002 (GRCm38) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,815,435 (GRCm38) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,832,652 (GRCm38) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,838,098 (GRCm38) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,783,900 (GRCm38) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,778,614 (GRCm38) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,786,759 (GRCm38) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,876,030 (GRCm38) nonsense probably null
R9564:Trpm6 UTSW 19 18,873,876 (GRCm38) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,813,482 (GRCm38) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,892,102 (GRCm38) missense probably benign
R9721:Trpm6 UTSW 19 18,829,972 (GRCm38) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,823,402 (GRCm38) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGGTGTTCTTGTAGCAATGAC -3'
(R):5'- GGGTGGGCAACTATTACCAG -3'

Sequencing Primer
(F):5'- GTTCTTGTAGCAATGACATCTAAAAG -3'
(R):5'- TGGGCAACTATTACCAGAAACTG -3'
Posted On 2016-02-04