Incidental Mutation 'R4791:Aldh1a1'
ID368636
Institutional Source Beutler Lab
Gene Symbol Aldh1a1
Ensembl Gene ENSMUSG00000053279
Gene Namealdehyde dehydrogenase family 1, subfamily A1
SynonymsAhd-2, Ahd2, ALDH1, Raldh1, E1
MMRRC Submission 041976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R4791 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location20492715-20643462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20619985 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 110 (N110S)
Ref Sequence ENSEMBL: ENSMUSP00000153011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087638] [ENSMUST00000225313] [ENSMUST00000225337]
Predicted Effect probably damaging
Transcript: ENSMUST00000087638
AA Change: N110S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084918
Gene: ENSMUSG00000053279
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 5.1e-185 PFAM
Pfam:LuxC 147 368 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225313
AA Change: N110S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225337
AA Change: N110S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.3917 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene show a significantly reduced ability to convert retinol to retinoic acid in the liver. Retinal morphology is normal even though the gene is normally highly expressed in the dorsal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G T 6: 50,595,837 P32Q probably damaging Het
Abcc6 C T 7: 45,982,160 V1231M probably benign Het
Agl A G 3: 116,786,528 probably null Het
Ak7 T C 12: 105,710,145 F35L probably benign Het
Arhgef5 C T 6: 43,283,183 L1368F probably damaging Het
Atp5j2 T C 5: 145,184,555 Y72C possibly damaging Het
Atp6v0a2 T G 5: 124,646,727 F317V probably benign Het
Bank1 A T 3: 136,254,929 S56T probably benign Het
BC080695 A G 4: 143,570,989 probably benign Het
Cachd1 T A 4: 100,918,085 C166S probably damaging Het
Cand1 A G 10: 119,210,702 I961T probably benign Het
Ccdc73 G A 2: 104,981,105 probably null Het
Cct6b A T 11: 82,742,004 probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Col6a4 A T 9: 106,080,202 V141E possibly damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cr2 A T 1: 195,155,935 C698S probably damaging Het
Diexf G A 1: 193,128,267 H143Y probably benign Het
Dnaaf5 C A 5: 139,184,650 Q786K possibly damaging Het
Dnah6 T C 6: 73,095,074 D2423G probably benign Het
Dnhd1 T C 7: 105,721,117 F4583S probably damaging Het
Duoxa2 A T 2: 122,301,198 T123S probably damaging Het
Edem1 T G 6: 108,841,634 V201G probably damaging Het
Eef1d C T 15: 75,903,682 A43T possibly damaging Het
Elavl3 T C 9: 22,024,678 K249E probably damaging Het
Epg5 G T 18: 77,948,996 E303* probably null Het
Fam83h T C 15: 76,002,368 D1040G probably damaging Het
Fndc7 A T 3: 108,876,659 F211L probably benign Het
Fsip2 A G 2: 82,982,108 T2924A possibly damaging Het
Gm5616 T C 9: 48,450,683 noncoding transcript Het
Gpr135 T A 12: 72,069,868 D375V probably benign Het
Hgd A G 16: 37,631,825 *446W probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Htra2 A G 6: 83,051,817 L379P probably damaging Het
Hypk G T 2: 121,457,655 probably null Het
Ica1l A G 1: 60,010,201 F198L probably damaging Het
Igsf11 G A 16: 39,024,864 S319N probably damaging Het
Il12rb1 T C 8: 70,813,368 S213P possibly damaging Het
Katnal1 C T 5: 148,904,650 V135M probably damaging Het
Kcnc4 G A 3: 107,447,543 P530S probably benign Het
Kcnu1 T C 8: 25,913,752 Y24H probably damaging Het
Kdm5b A G 1: 134,630,800 E1515G possibly damaging Het
Kif18a A T 2: 109,287,875 M12L probably benign Het
Klre1 T C 6: 129,584,155 S160P probably damaging Het
Lama2 A T 10: 27,467,271 H68Q probably damaging Het
Lgals8 T C 13: 12,453,322 K49R possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lsr T C 7: 30,958,552 T328A probably damaging Het
Mark4 C T 7: 19,451,657 E51K probably benign Het
Mindy2 T C 9: 70,634,001 probably null Het
Mkks G A 2: 136,876,162 T400I probably benign Het
Mon2 T A 10: 123,006,057 M1544L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c T G 9: 75,290,916 L1341R probably damaging Het
Nin T C 12: 70,043,807 R945G possibly damaging Het
Nox4 T C 7: 87,304,847 V120A probably benign Het
Olfr1196 C T 2: 88,700,898 V144I probably benign Het
Olfr1496 T A 19: 13,781,342 C243* probably null Het
Olfr169 G T 16: 19,566,663 H73Q possibly damaging Het
Olfr30 A T 11: 58,455,544 V135E possibly damaging Het
Olfr847 T C 9: 19,375,809 E24G probably benign Het
Plekha2 T A 8: 25,042,762 R398W probably damaging Het
Pradc1 A G 6: 85,447,191 W58R probably damaging Het
Prrc2b A G 2: 32,217,339 probably null Het
Psg19 T A 7: 18,794,146 N224I probably damaging Het
Ranbp17 A C 11: 33,487,746 V164G probably benign Het
Rasgrp3 A G 17: 75,500,173 S211G probably benign Het
Rcc1l G A 5: 134,163,776 P270S possibly damaging Het
Rfx6 T A 10: 51,719,944 probably null Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Selenof T G 3: 144,596,823 Y120D probably damaging Het
Sema3b G T 9: 107,603,813 D108E probably damaging Het
Shank3 T A 15: 89,500,354 L143Q probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sirt4 T C 5: 115,480,314 T234A possibly damaging Het
Slc25a30 C A 14: 75,763,366 W266L probably benign Het
Spata20 A T 11: 94,484,586 N127K probably damaging Het
St14 C T 9: 31,095,622 G636D probably benign Het
Stat5a G A 11: 100,865,463 E170K probably damaging Het
Sugp2 C T 8: 70,242,790 R138C probably damaging Het
Sult1e1 C A 5: 87,586,730 W119L possibly damaging Het
Sv2a T C 3: 96,192,558 V608A possibly damaging Het
Syne2 T C 12: 75,909,244 Y575H possibly damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Thoc6 T C 17: 23,670,067 H151R possibly damaging Het
Tm9sf2 T C 14: 122,139,650 S197P probably benign Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tmx2 G A 2: 84,677,996 P15L probably damaging Het
Top1mt C T 15: 75,668,625 probably null Het
Trpm6 T A 19: 18,867,981 S1682T probably benign Het
Trrap C T 5: 144,803,277 R1171W probably damaging Het
Ugt3a2 A G 15: 9,361,579 D147G probably damaging Het
Vnn3 A G 10: 23,864,621 H274R probably benign Het
Vwf C A 6: 125,643,363 T1668K Het
Zfp568 T C 7: 30,015,183 S162P probably damaging Het
Zfp658 T A 7: 43,574,466 C722S possibly damaging Het
Zfp808 T A 13: 62,171,231 H91Q probably damaging Het
Other mutations in Aldh1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aldh1a1 APN 19 20619997 missense probably benign 0.13
IGL01769:Aldh1a1 APN 19 20642919 missense probably benign 0.29
IGL02745:Aldh1a1 APN 19 20636664 splice site probably benign
IGL02989:Aldh1a1 APN 19 20640058 splice site probably benign
IGL03154:Aldh1a1 APN 19 20630768 missense probably benign 0.21
LCD18:Aldh1a1 UTSW 19 20626646 intron probably benign
R0265:Aldh1a1 UTSW 19 20640076 nonsense probably null
R0282:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0418:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0471:Aldh1a1 UTSW 19 20602013 start codon destroyed probably null 0.99
R0556:Aldh1a1 UTSW 19 20634478 missense probably damaging 1.00
R0755:Aldh1a1 UTSW 19 20617994 missense probably benign
R1164:Aldh1a1 UTSW 19 20617946 missense probably benign 0.11
R1692:Aldh1a1 UTSW 19 20630818 missense probably damaging 1.00
R1905:Aldh1a1 UTSW 19 20617998 missense probably damaging 1.00
R2127:Aldh1a1 UTSW 19 20642915 missense probably benign 0.00
R2281:Aldh1a1 UTSW 19 20620091 missense possibly damaging 0.88
R2475:Aldh1a1 UTSW 19 20640078 missense probably benign
R3871:Aldh1a1 UTSW 19 20624753 nonsense probably null
R4607:Aldh1a1 UTSW 19 20621687 missense probably benign 0.35
R4725:Aldh1a1 UTSW 19 20640081 missense probably benign
R4792:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4844:Aldh1a1 UTSW 19 20634400 missense probably benign 0.00
R5639:Aldh1a1 UTSW 19 20623422 missense probably damaging 1.00
R5669:Aldh1a1 UTSW 19 20610920 missense probably damaging 1.00
R5815:Aldh1a1 UTSW 19 20630670 missense probably benign 0.00
R6387:Aldh1a1 UTSW 19 20617959 missense probably damaging 0.99
R7078:Aldh1a1 UTSW 19 20602070 missense probably benign
R7282:Aldh1a1 UTSW 19 20629070 missense possibly damaging 0.68
R7334:Aldh1a1 UTSW 19 20621711 missense probably damaging 1.00
R7578:Aldh1a1 UTSW 19 20618002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCTACCAGGACCTTGATATG -3'
(R):5'- CATTGTGATAGTGGCCTGGC -3'

Sequencing Primer
(F):5'- ATGTGATCACTGCTCTCAGAG -3'
(R):5'- GCCTCTGTCACAATCGCCATTAG -3'
Posted On2016-02-04