Incidental Mutation 'R4792:Psapl1'
ID368658
Institutional Source Beutler Lab
Gene Symbol Psapl1
Ensembl Gene ENSMUSG00000043430
Gene Nameprosaposin-like 1
Synonyms2310020A21Rik
MMRRC Submission 042419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4792 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location36204021-36206568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36205203 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 380 (S380P)
Ref Sequence ENSEMBL: ENSMUSP00000100594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000052224] [ENSMUST00000070720] [ENSMUST00000135324]
Predicted Effect probably benign
Transcript: ENSMUST00000037370
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052224
AA Change: S380P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100594
Gene: ENSMUSG00000043430
AA Change: S380P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SAPA 25 58 1.19e-12 SMART
SapB 65 143 9.63e-7 SMART
SapB 188 260 8.51e-8 SMART
SapB 296 370 9.82e-22 SMART
SapB 398 473 8.37e-16 SMART
SAPA 482 515 2.01e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070720
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135324
SMART Domains Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
SCOP:d1eur__ 1 111 2e-3 SMART
Blast:VPS10 1 173 1e-126 BLAST
PDB:4N7E|A 6 117 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141508
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Alox5 C A 6: 116,461,003 V8L possibly damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Herc1 T A 9: 66,495,984 V4395E possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ick A G 9: 78,153,693 D207G probably damaging Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgr6 T A 1: 135,021,806 S229C probably benign Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naglu C T 11: 101,071,106 T135M probably damaging Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Psapl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Psapl1 APN 5 36205631 missense probably benign
IGL01873:Psapl1 APN 5 36205225 missense possibly damaging 0.66
IGL02590:Psapl1 APN 5 36205053 missense probably benign
IGL02931:Psapl1 APN 5 36204889 missense probably damaging 1.00
R0138:Psapl1 UTSW 5 36204631 missense probably damaging 0.98
R0570:Psapl1 UTSW 5 36204280 missense possibly damaging 0.89
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R2207:Psapl1 UTSW 5 36205165 missense probably damaging 1.00
R2247:Psapl1 UTSW 5 36205066 missense probably benign 0.01
R4865:Psapl1 UTSW 5 36204867 missense probably damaging 1.00
R5101:Psapl1 UTSW 5 36204150 missense probably damaging 1.00
R5947:Psapl1 UTSW 5 36204307 missense probably benign 0.08
R6015:Psapl1 UTSW 5 36204250 missense probably benign 0.00
R6751:Psapl1 UTSW 5 36204959 nonsense probably null
R7260:Psapl1 UTSW 5 36205212 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGGCTTGTGACCAACAGC -3'
(R):5'- GTTGCACTGCATCACATAAGGC -3'

Sequencing Primer
(F):5'- GCTTGTGACCAACAGCACAGAAG -3'
(R):5'- TGCATCACATAAGGCAACGG -3'
Posted On2016-02-04