Incidental Mutation 'R4792:Naglu'
ID368698
Institutional Source Beutler Lab
Gene Symbol Naglu
Ensembl Gene ENSMUSG00000001751
Gene Namealpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Synonyms
MMRRC Submission 042419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4792 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101070012-101077672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101071106 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 135 (T135M)
Ref Sequence ENSEMBL: ENSMUSP00000001802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001802]
Predicted Effect probably damaging
Transcript: ENSMUST00000001802
AA Change: T135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001802
Gene: ENSMUSG00000001751
AA Change: T135M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NAGLU_N 28 114 4.8e-24 PFAM
Pfam:NAGLU 128 463 8.2e-150 PFAM
Pfam:NAGLU_C 471 731 4.5e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140735
Meta Mutation Damage Score 0.9518 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced open field activity, massive accumulation of heparan sulfate in kidney and liver, elevated gangliosides in brain, and presence of vacuoles in macrophages, epithelial cells, and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik A G 13: 24,746,507 probably benign Het
2310061N02Rik A G 16: 88,707,763 S49P possibly damaging Het
Abcb1a T C 5: 8,746,657 probably null Het
Adgb G A 10: 10,398,903 T770I probably damaging Het
Adgre4 A T 17: 55,791,491 T134S probably benign Het
Aldh1a1 A G 19: 20,619,985 N110S probably damaging Het
Alox5 C A 6: 116,461,003 V8L possibly damaging Het
Ambra1 A G 2: 91,772,846 T392A possibly damaging Het
Apob A G 12: 8,008,051 I2145V probably benign Het
Arhgap39 A G 15: 76,741,517 Y196H possibly damaging Het
Carmil1 A G 13: 24,067,190 L439S probably damaging Het
Carmil1 A T 13: 24,141,676 S224T possibly damaging Het
Cfh G A 1: 140,100,823 Q706* probably null Het
Chd2 A C 7: 73,468,577 S1098A probably benign Het
Chrna5 A T 9: 55,004,701 I158F probably damaging Het
Col6a5 T C 9: 105,930,784 T1022A unknown Het
Cul7 T A 17: 46,657,050 Y423* probably null Het
Cyp2e1 T C 7: 140,773,675 Y342H probably benign Het
D630045J12Rik T C 6: 38,148,340 K1580E probably damaging Het
Dnah6 A G 6: 73,089,668 M2573T probably damaging Het
Edem1 T A 6: 108,828,746 probably benign Het
Erp29 C T 5: 121,447,174 E86K probably benign Het
Esrp2 C A 8: 106,132,509 R535L probably damaging Het
Gabrb2 C T 11: 42,529,503 probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Herc1 T A 9: 66,495,984 V4395E possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgb2 G A 8: 57,513,310 C106Y probably damaging Het
Hoxa10 T C 6: 52,232,501 probably benign Het
Hsd3b1 T A 3: 98,852,910 Y255F probably benign Het
Ick A G 9: 78,153,693 D207G probably damaging Het
Ighd T C 12: 113,416,199 K42E probably benign Het
Ighv1-26 T C 12: 114,788,571 Y51C possibly damaging Het
Ighv5-2 C T 12: 113,578,799 E19K possibly damaging Het
Ipo11 T C 13: 106,834,160 probably benign Het
Itk C T 11: 46,344,831 probably benign Het
Kat6a T A 8: 22,940,576 H1982Q unknown Het
Kdm4d C T 9: 14,463,390 V391I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgr6 T A 1: 135,021,806 S229C probably benign Het
Lhx9 T A 1: 138,838,351 Y233F possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Mapk4 T C 18: 73,937,250 T191A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nomo1 T A 7: 46,044,219 probably null Het
Nop56 T A 2: 130,277,864 V75E possibly damaging Het
Nr1i3 G A 1: 171,218,595 C283Y probably damaging Het
Olfr1269 T A 2: 90,118,830 Y256F possibly damaging Het
Olfr557 G A 7: 102,698,726 G163R probably damaging Het
Olfr768 T G 10: 129,093,620 Y118S probably damaging Het
Pcdhga2 A G 18: 37,669,399 S99G probably benign Het
Pcnx T A 12: 81,919,151 D697E probably damaging Het
Plxnb1 G A 9: 109,110,648 D1462N probably damaging Het
Pnn G T 12: 59,072,205 V525F possibly damaging Het
Prrc2a A T 17: 35,156,487 D1062E probably damaging Het
Prss35 T A 9: 86,755,669 V164E probably damaging Het
Psapl1 T C 5: 36,205,203 S380P probably benign Het
Rnf222 A T 11: 68,893,019 E137D probably damaging Het
Rsph10b A G 5: 143,937,317 T79A probably damaging Het
Sbf2 T C 7: 110,351,610 Q1164R probably damaging Het
Scn7a T C 2: 66,726,248 D331G probably damaging Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Sspo G A 6: 48,461,585 S1529N probably benign Het
St8sia3 T A 18: 64,265,563 V31E probably benign Het
Sult1b1 A T 5: 87,515,047 W265R probably damaging Het
Supt5 G T 7: 28,316,329 Q863K probably benign Het
Tbc1d31 A G 15: 57,940,728 R380G probably benign Het
Tdpoz1 T A 3: 93,670,538 D313V possibly damaging Het
Tmem260 CAGGGACCGGCATAG CAG 14: 48,511,994 probably benign Het
Tpx2 A T 2: 152,885,096 T428S probably damaging Het
Trip11 A T 12: 101,885,446 H786Q probably benign Het
Trpc6 A T 9: 8,626,614 M322L probably benign Het
Try10 T C 6: 41,355,452 V14A probably benign Het
Unc13d A T 11: 116,070,282 F416L probably damaging Het
Vmn2r75 A T 7: 86,163,170 M547K possibly damaging Het
Wdr78 T C 4: 103,072,684 K370R possibly damaging Het
Zbp1 A G 2: 173,209,213 F288S probably damaging Het
Zc3h11a T A 1: 133,640,698 Q71L probably damaging Het
Zfp40 G A 17: 23,177,034 T193I possibly damaging Het
Zfp607a T C 7: 27,878,653 Y383H probably benign Het
Zfp622 T A 15: 25,987,042 Y82* probably null Het
Zfp964 T C 8: 69,664,015 F422L probably benign Het
Other mutations in Naglu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Naglu APN 11 101076952 missense possibly damaging 0.84
IGL01025:Naglu APN 11 101073947 missense probably benign 0.01
IGL01775:Naglu APN 11 101074095 missense probably damaging 1.00
tulane UTSW 11 101070332 missense probably benign 0.01
R0044:Naglu UTSW 11 101071217 missense probably damaging 0.99
R0281:Naglu UTSW 11 101074027 missense probably damaging 0.99
R0395:Naglu UTSW 11 101074107 unclassified probably benign
R1624:Naglu UTSW 11 101076525 missense probably damaging 1.00
R1739:Naglu UTSW 11 101076403 missense possibly damaging 0.88
R2092:Naglu UTSW 11 101076720 missense possibly damaging 0.94
R4118:Naglu UTSW 11 101074082 missense probably benign 0.39
R4582:Naglu UTSW 11 101071929 missense probably damaging 0.97
R4834:Naglu UTSW 11 101076988 missense probably benign
R5232:Naglu UTSW 11 101070150 missense probably benign 0.02
R5387:Naglu UTSW 11 101076724 missense probably damaging 1.00
R6463:Naglu UTSW 11 101077351 unclassified probably null
R6483:Naglu UTSW 11 101071181 missense probably damaging 1.00
R7141:Naglu UTSW 11 101072230 missense probably benign 0.10
R7187:Naglu UTSW 11 101070332 missense probably benign 0.01
R7232:Naglu UTSW 11 101076426 missense probably damaging 1.00
R7478:Naglu UTSW 11 101071899 missense probably damaging 1.00
R7828:Naglu UTSW 11 101076610 missense probably damaging 0.99
R7829:Naglu UTSW 11 101076610 missense probably damaging 0.99
X0023:Naglu UTSW 11 101072014 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCGAGGTGGATTTGGAATGAGC -3'
(R):5'- ACTTTGTCCCACCCTGGAAG -3'

Sequencing Primer
(F):5'- TGGATTTGGAATGAGCAGGAG -3'
(R):5'- TGGAAGGCCTCGGTTTCC -3'
Posted On2016-02-04