Incidental Mutation 'R4793:Slc26a5'
ID368756
Institutional Source Beutler Lab
Gene Symbol Slc26a5
Ensembl Gene ENSMUSG00000029015
Gene Namesolute carrier family 26, member 5
SynonymsPres, prestin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21810655-21865604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21837994 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 153 (P153S)
Ref Sequence ENSEMBL: ENSMUSP00000118263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]
Predicted Effect probably damaging
Transcript: ENSMUST00000030878
AA Change: P153S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: P153S

DomainStartEndE-ValueType
Pfam:Sulfate_transp 80 475 3.3e-109 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Pfam:STAS 526 709 3.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115176
AA Change: P116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: P116S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 106 5.2e-9 PFAM
Pfam:Sulfate_transp 156 434 1.6e-65 PFAM
transmembrane domain 439 461 N/A INTRINSIC
Pfam:STAS 489 672 1.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127975
AA Change: P153S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: P153S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 4.3e-33 PFAM
Pfam:Sulfate_transp 193 440 8.9e-56 PFAM
transmembrane domain 447 469 N/A INTRINSIC
Pfam:STAS 494 677 4.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142888
AA Change: P153S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: P153S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 2.1e-33 PFAM
Pfam:Sulfate_transp 193 441 9.6e-49 PFAM
Meta Mutation Damage Score 0.2647 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Slc26a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Slc26a5 APN 5 21815736 missense probably damaging 1.00
IGL02486:Slc26a5 APN 5 21846325 missense probably damaging 1.00
IGL02639:Slc26a5 APN 5 21819767 missense probably damaging 1.00
IGL02810:Slc26a5 APN 5 21813383 splice site probably benign
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0089:Slc26a5 UTSW 5 21811344 splice site probably null
R0136:Slc26a5 UTSW 5 21834347 missense probably damaging 1.00
R0212:Slc26a5 UTSW 5 21823549 nonsense probably null
R0522:Slc26a5 UTSW 5 21846345 missense probably damaging 0.96
R0557:Slc26a5 UTSW 5 21819764 missense probably damaging 1.00
R0711:Slc26a5 UTSW 5 21847232 missense probably damaging 1.00
R0959:Slc26a5 UTSW 5 21816961 missense probably benign 0.01
R1214:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R1471:Slc26a5 UTSW 5 21816964 missense probably benign 0.12
R1647:Slc26a5 UTSW 5 21813976 nonsense probably null
R1648:Slc26a5 UTSW 5 21813976 nonsense probably null
R1861:Slc26a5 UTSW 5 21816958 missense possibly damaging 0.93
R1875:Slc26a5 UTSW 5 21815727 missense probably benign 0.03
R2106:Slc26a5 UTSW 5 21823544 missense probably damaging 1.00
R2169:Slc26a5 UTSW 5 21813865 missense probably damaging 1.00
R2219:Slc26a5 UTSW 5 21823478 missense probably damaging 1.00
R2276:Slc26a5 UTSW 5 21823547 missense probably benign 0.39
R2281:Slc26a5 UTSW 5 21831510 missense possibly damaging 0.94
R2325:Slc26a5 UTSW 5 21819694 missense probably damaging 1.00
R4031:Slc26a5 UTSW 5 21847191 missense probably damaging 1.00
R4941:Slc26a5 UTSW 5 21820386 missense probably damaging 1.00
R5122:Slc26a5 UTSW 5 21847196 missense probably damaging 1.00
R5274:Slc26a5 UTSW 5 21813901 missense possibly damaging 0.74
R5312:Slc26a5 UTSW 5 21847260 missense probably damaging 0.99
R5628:Slc26a5 UTSW 5 21816976 missense probably benign 0.20
R5806:Slc26a5 UTSW 5 21823563 missense probably damaging 1.00
R6227:Slc26a5 UTSW 5 21821097 missense probably damaging 1.00
R6525:Slc26a5 UTSW 5 21820350 missense possibly damaging 0.77
R6609:Slc26a5 UTSW 5 21819719 missense possibly damaging 0.93
R6885:Slc26a5 UTSW 5 21834344 missense probably damaging 1.00
R6974:Slc26a5 UTSW 5 21840572 missense probably damaging 1.00
R7001:Slc26a5 UTSW 5 21811336 missense probably damaging 1.00
R7027:Slc26a5 UTSW 5 21816974 missense possibly damaging 0.60
R7174:Slc26a5 UTSW 5 21813894 missense probably damaging 1.00
R7184:Slc26a5 UTSW 5 21837246 nonsense probably null
R7650:Slc26a5 UTSW 5 21834330 missense possibly damaging 0.96
R8431:Slc26a5 UTSW 5 21813906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTCTGCCCACACATAG -3'
(R):5'- AAGTCACTCAGGGTCTCTGC -3'

Sequencing Primer
(F):5'- GCCAAGAGAATTCAATAGGCATTTC -3'
(R):5'- GCTCCATTCTTTTGGCTAAAATTAAG -3'
Posted On2016-02-04