Mutagenetix > Incidental Mutations

Incidental Mutation 'R4793:Slc26a5'

368756

Institutional Source

Beutler Lab

Gene Symbol

Slc26a5

Ensembl Gene

ENSMUSG00000029015

Gene Name

solute carrier family 26, member 5

Synonyms

Pres, prestin

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4793 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21810655-21865604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21837994 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 153 (P153S)

Ref Sequence

ENSEMBL: ENSMUSP00000118263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030878
AA Change: P153S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: P153S

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	80	475	3.3e-109	PFAM
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:STAS	526	709	3.3e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115176
AA Change: P116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: P116S

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	106	5.2e-9	PFAM
Pfam:Sulfate_transp	156	434	1.6e-65	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
Pfam:STAS	489	672	1.5e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127975
AA Change: P153S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: P153S

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	4.3e-33	PFAM
Pfam:Sulfate_transp	193	440	8.9e-56	PFAM
transmembrane domain	447	469	N/A	INTRINSIC
Pfam:STAS	494	677	4.1e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000142888
AA Change: P153S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: P153S

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	2.1e-33	PFAM
Pfam:Sulfate_transp	193	441	9.6e-49	PFAM

Meta Mutation Damage Score

0.2647

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	A	11: 110,191,718	E1143V	probably benign	Het
Abi2	T	A	1: 60,409,804	M1K	probably null	Het
Acp2	T	C	2: 91,206,789	F205L	probably benign	Het
Adam17	T	C	12: 21,347,395	N219D	probably benign	Het
Aldh2	T	C	5: 121,568,979	S168G	probably damaging	Het
Arhgap15	A	T	2: 44,142,341	E312D	probably damaging	Het
BC017158	A	T	7: 128,288,202		probably benign	Het
Calm5	T	C	13: 3,854,401	S32P	probably benign	Het
Capn12	G	A	7: 28,892,669	D671N	probably benign	Het
Ccdc73	A	G	2: 105,017,782		probably null	Het
Cdc20	T	A	4: 118,437,064	I20F	probably benign	Het
Cdh23	A	T	10: 60,331,350	I1841N	probably damaging	Het
Cftr	T	C	6: 18,226,088	V345A	probably damaging	Het
Col15a1	T	C	4: 47,262,997	S550P	possibly damaging	Het
Col4a4	A	G	1: 82,539,099	Y133H	unknown	Het
Csmd1	A	G	8: 16,088,263	S1592P	probably damaging	Het
Cts6	T	A	13: 61,201,812	M56L	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Diexf	T	A	1: 193,113,808	Q50L	probably null	Het
Dock5	A	G	14: 67,800,354	S947P	probably benign	Het
Dpysl2	G	T	14: 66,815,049	A339D	possibly damaging	Het
Ebf2	A	G	14: 67,410,082	D360G	probably damaging	Het
Ensa	T	C	3: 95,625,178		probably null	Het
Fap	C	A	2: 62,544,369	V229F	probably damaging	Het
Fbn1	C	A	2: 125,321,235	G2116*	probably null	Het
Frmd4b	A	T	6: 97,295,861	S857T	probably damaging	Het
Fsip2	T	A	2: 82,987,700	Y4592*	probably null	Het
Fubp1	T	A	3: 152,223,329	Y135N	possibly damaging	Het
Gdap2	T	C	3: 100,170,918	L66P	probably damaging	Het
Gm10257	T	C	13: 100,946,797		noncoding transcript	Het
Gm1758	A	T	16: 14,507,172		noncoding transcript	Het
Gna13	T	C	11: 109,363,629		probably benign	Het
Heatr1	T	C	13: 12,431,837	I1689T	probably benign	Het
Hephl1	A	G	9: 15,097,990	I102T	probably benign	Het
Hist1h2bl	T	C	13: 21,715,918	S76G	probably benign	Het
Hltf	T	G	3: 20,063,950	Y121D	possibly damaging	Het
Hspg2	T	C	4: 137,529,473	V1509A	possibly damaging	Het
Ifitm5	G	T	7: 140,950,164	R16S	probably benign	Het
Il1rap	A	C	16: 26,695,234	D239A	probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kcna6	T	C	6: 126,738,556	I457V	probably damaging	Het
Kctd17	T	A	15: 78,433,024	L47Q	probably damaging	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrrc63	A	G	14: 75,126,161	S177P	possibly damaging	Het
Lrriq1	T	C	10: 103,170,466	D1266G	probably benign	Het
Map3k2	G	T	18: 32,228,150	M554I	probably damaging	Het
Mettl7a3	A	G	15: 100,335,008	M27V	probably benign	Het
Mst1r	T	A	9: 107,919,925	V1331E	probably damaging	Het
Musk	T	C	4: 58,373,400	I775T	probably damaging	Het
Mybl2	A	G	2: 163,074,763	K7E	probably damaging	Het
Nf1	T	C	11: 79,447,572	S1137P	probably damaging	Het
Nlrp5	A	G	7: 23,417,630	I260V	probably damaging	Het
Olfr1006	A	C	2: 85,674,498	Y218D	probably damaging	Het
Olfr1413	G	T	1: 92,573,485	A105S	possibly damaging	Het
Olfr155	A	T	4: 43,854,323	N5Y	probably benign	Het
Pabpc1l	C	T	2: 164,027,622	A114V	possibly damaging	Het
Plac8l1	T	A	18: 42,178,908	I149F	possibly damaging	Het
Pou6f1	T	A	15: 100,578,412	N531I	probably damaging	Het
Prdm10	A	G	9: 31,353,405	Y712C	probably damaging	Het
Ptbp3	T	C	4: 59,514,297	T43A	possibly damaging	Het
Ptpn13	T	C	5: 103,582,778		probably null	Het
Rnf135	T	C	11: 80,196,949		probably null	Het
Serpinb3d	A	G	1: 107,078,221	L379P	probably damaging	Het
Sh2d6	T	A	6: 72,517,598	T124S	probably benign	Het
Slc5a7	A	G	17: 54,281,794	F275S	possibly damaging	Het
Snx14	A	G	9: 88,394,442	S606P	probably damaging	Het
Sphkap	A	T	1: 83,278,084	I648K	possibly damaging	Het
Spon2	T	C	5: 33,214,560	T301A	probably damaging	Het
Srpr	C	T	9: 35,213,151	T48I	probably benign	Het
Taar9	G	A	10: 24,109,510	P9S	probably benign	Het
Tacc1	A	T	8: 25,182,389	S274R	possibly damaging	Het
Tc2n	A	G	12: 101,651,117	S348P	possibly damaging	Het
Timd2	G	T	11: 46,687,181	T41K	probably damaging	Het
Tmem132a	T	A	19: 10,865,493	E206V	probably damaging	Het
Tpi1	A	T	6: 124,812,581		probably benign	Het
Traf5	T	G	1: 191,997,804	T429P	probably benign	Het
Trav4-3	A	G	14: 53,599,158	S27G	possibly damaging	Het
Tubd1	T	C	11: 86,567,069	M462T	probably benign	Het
Ube4a	T	C	9: 44,948,822	D314G	probably damaging	Het
Vmn2r58	G	T	7: 41,865,071	T158K	probably damaging	Het
Vmn2r68	C	A	7: 85,234,440	M152I	probably benign	Het
Vmn2r91	A	G	17: 18,105,396	E92G	probably damaging	Het
Wdr20rt	T	C	12: 65,226,621	V113A	probably damaging	Het
Zfp729a	T	C	13: 67,620,427	H561R	probably damaging	Het
Zfp804a	T	A	2: 82,235,842	D52E	probably damaging	Het

Other mutations in Slc26a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Slc26a5	APN	5	21815736	missense	probably damaging	1.00
IGL02486:Slc26a5	APN	5	21846325	missense	probably damaging	1.00
IGL02639:Slc26a5	APN	5	21819767	missense	probably damaging	1.00
IGL02810:Slc26a5	APN	5	21813383	splice site	probably benign
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0002:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R0089:Slc26a5	UTSW	5	21811344	splice site	probably null
R0136:Slc26a5	UTSW	5	21834347	missense	probably damaging	1.00
R0212:Slc26a5	UTSW	5	21823549	nonsense	probably null
R0522:Slc26a5	UTSW	5	21846345	missense	probably damaging	0.96
R0557:Slc26a5	UTSW	5	21819764	missense	probably damaging	1.00
R0711:Slc26a5	UTSW	5	21847232	missense	probably damaging	1.00
R0959:Slc26a5	UTSW	5	21816961	missense	probably benign	0.01
R1214:Slc26a5	UTSW	5	21814983	missense	probably damaging	1.00
R1471:Slc26a5	UTSW	5	21816964	missense	probably benign	0.12
R1647:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1648:Slc26a5	UTSW	5	21813976	nonsense	probably null
R1861:Slc26a5	UTSW	5	21816958	missense	possibly damaging	0.93
R1875:Slc26a5	UTSW	5	21815727	missense	probably benign	0.03
R2106:Slc26a5	UTSW	5	21823544	missense	probably damaging	1.00
R2169:Slc26a5	UTSW	5	21813865	missense	probably damaging	1.00
R2219:Slc26a5	UTSW	5	21823478	missense	probably damaging	1.00
R2276:Slc26a5	UTSW	5	21823547	missense	probably benign	0.39
R2281:Slc26a5	UTSW	5	21831510	missense	possibly damaging	0.94
R2325:Slc26a5	UTSW	5	21819694	missense	probably damaging	1.00
R4031:Slc26a5	UTSW	5	21847191	missense	probably damaging	1.00
R4941:Slc26a5	UTSW	5	21820386	missense	probably damaging	1.00
R5122:Slc26a5	UTSW	5	21847196	missense	probably damaging	1.00
R5274:Slc26a5	UTSW	5	21813901	missense	possibly damaging	0.74
R5312:Slc26a5	UTSW	5	21847260	missense	probably damaging	0.99
R5628:Slc26a5	UTSW	5	21816976	missense	probably benign	0.20
R5806:Slc26a5	UTSW	5	21823563	missense	probably damaging	1.00
R6227:Slc26a5	UTSW	5	21821097	missense	probably damaging	1.00
R6525:Slc26a5	UTSW	5	21820350	missense	possibly damaging	0.77
R6609:Slc26a5	UTSW	5	21819719	missense	possibly damaging	0.93
R6885:Slc26a5	UTSW	5	21834344	missense	probably damaging	1.00
R6974:Slc26a5	UTSW	5	21840572	missense	probably damaging	1.00
R7001:Slc26a5	UTSW	5	21811336	missense	probably damaging	1.00
R7027:Slc26a5	UTSW	5	21816974	missense	possibly damaging	0.60
R7174:Slc26a5	UTSW	5	21813894	missense	probably damaging	1.00
R7184:Slc26a5	UTSW	5	21837246	nonsense	probably null
R7650:Slc26a5	UTSW	5	21834330	missense	possibly damaging	0.96
R8431:Slc26a5	UTSW	5	21813906	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACTCTGCCCACACATAG -3'
(R):5'- AAGTCACTCAGGGTCTCTGC -3'

Sequencing Primer
(F):5'- GCCAAGAGAATTCAATAGGCATTTC -3'
(R):5'- GCTCCATTCTTTTGGCTAAAATTAAG -3'

Posted On

2016-02-04