Incidental Mutation 'R4793:Nlrp5'
ID368765
Institutional Source Beutler Lab
Gene Symbol Nlrp5
Ensembl Gene ENSMUSG00000015721
Gene NameNLR family, pyrin domain containing 5
SynonymsMater, Nalp5, Op1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4793 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23385889-23441922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23417630 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 260 (I260V)
Ref Sequence ENSEMBL: ENSMUSP00000104080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015866] [ENSMUST00000086341] [ENSMUST00000108441] [ENSMUST00000133237] [ENSMUST00000139661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015866
AA Change: I260V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015866
Gene: ENSMUSG00000015721
AA Change: I260V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 3.5e-45 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1031 6.04e1 SMART
LRR 1032 1059 1.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086341
AA Change: I244V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083524
Gene: ENSMUSG00000015721
AA Change: I244V

DomainStartEndE-ValueType
Pfam:NACHT 175 343 1.5e-44 PFAM
LRR 675 702 4.51e1 SMART
LRR 731 758 1.36e-2 SMART
LRR 760 787 6.79e0 SMART
LRR 788 815 4.3e0 SMART
LRR 817 844 1.42e0 SMART
LRR 845 872 1.2e-3 SMART
LRR 874 901 1.2e2 SMART
LRR 902 929 2.2e-2 SMART
LRR 931 958 1.56e2 SMART
LRR 959 986 3.36e-7 SMART
LRR 988 1015 6.04e1 SMART
LRR 1016 1043 1.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108441
AA Change: I260V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104080
Gene: ENSMUSG00000015721
AA Change: I260V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.5e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1033 1.28e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133237
AA Change: I260V

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122007
Gene: ENSMUSG00000015721
AA Change: I260V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.3e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139661
AA Change: I260V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118638
Gene: ENSMUSG00000015721
AA Change: I260V

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.6e-44 PFAM
Blast:LRR 691 718 8e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207536
Meta Mutation Damage Score 0.3214 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a member of the NACHT, leucine-rich repeat, and pyrin domain containing family. Members of this family have a pyrin domain at the N-terminus, a central NACHT domain, and a C-terminal leucine-rich repeat domain. This gene encodes a maternal-effect factor that is essential for early embryonic development in the mouse. Homozygous null mutant females are sterile, and embryos die following the first cleavage. This gene is required for endoplasmic reticulum redistribution and calcium homeostasis in oocytes. In addition, ovulated oocytes mutant for this gene have abnormal mitochondrial localization and increased mitochondrial activity, which results in mitochondrial damage and early embryonic lethality. Pseudogenes of this gene have been found on chromosomes 7 and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Females lacking this maternal effect gene are sterile. Preimplantation embryos do not develop past the 2-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Nlrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Nlrp5 APN 7 23441788 missense probably damaging 1.00
IGL01393:Nlrp5 APN 7 23404174 missense probably null 0.04
IGL01505:Nlrp5 APN 7 23417734 missense probably benign 0.15
IGL02010:Nlrp5 APN 7 23417372 missense probably benign 0.04
IGL02223:Nlrp5 APN 7 23430022 splice site probably benign
IGL02341:Nlrp5 APN 7 23404152 missense probably benign 0.43
IGL02532:Nlrp5 APN 7 23409973 missense possibly damaging 0.70
IGL02619:Nlrp5 APN 7 23424064 critical splice donor site probably null
IGL02659:Nlrp5 APN 7 23418581 missense probably damaging 1.00
IGL02828:Nlrp5 APN 7 23421460 missense possibly damaging 0.81
IGL03018:Nlrp5 APN 7 23417747 missense probably benign 0.06
IGL03164:Nlrp5 APN 7 23418373 nonsense probably null
IGL03397:Nlrp5 APN 7 23413334 missense probably damaging 1.00
IGL03404:Nlrp5 APN 7 23430034 missense probably benign 0.00
R0310:Nlrp5 UTSW 7 23430157 missense probably damaging 0.99
R0549:Nlrp5 UTSW 7 23441802 missense probably damaging 1.00
R0573:Nlrp5 UTSW 7 23417631 missense probably damaging 1.00
R0647:Nlrp5 UTSW 7 23417707 missense probably damaging 1.00
R0675:Nlrp5 UTSW 7 23417417 missense possibly damaging 0.53
R0826:Nlrp5 UTSW 7 23417708 missense probably benign 0.13
R1511:Nlrp5 UTSW 7 23413347 missense probably damaging 0.99
R1620:Nlrp5 UTSW 7 23418639 missense probably damaging 1.00
R1858:Nlrp5 UTSW 7 23418161 missense probably damaging 0.98
R1867:Nlrp5 UTSW 7 23423982 missense possibly damaging 0.85
R1887:Nlrp5 UTSW 7 23417484 missense probably damaging 1.00
R1899:Nlrp5 UTSW 7 23404797 missense probably benign 0.00
R1901:Nlrp5 UTSW 7 23423910 missense possibly damaging 0.94
R2032:Nlrp5 UTSW 7 23421512 missense probably damaging 1.00
R3083:Nlrp5 UTSW 7 23430163 missense probably benign 0.03
R3806:Nlrp5 UTSW 7 23404846 missense probably benign
R3907:Nlrp5 UTSW 7 23433646 missense possibly damaging 0.48
R4085:Nlrp5 UTSW 7 23430098 missense probably damaging 0.97
R4135:Nlrp5 UTSW 7 23418398 missense possibly damaging 0.92
R4609:Nlrp5 UTSW 7 23417748 missense probably benign 0.01
R4649:Nlrp5 UTSW 7 23418178 missense probably damaging 1.00
R4780:Nlrp5 UTSW 7 23435778 missense probably damaging 1.00
R5062:Nlrp5 UTSW 7 23435910 nonsense probably null
R5224:Nlrp5 UTSW 7 23417976 missense probably damaging 1.00
R5364:Nlrp5 UTSW 7 23418328 nonsense probably null
R5426:Nlrp5 UTSW 7 23418201 missense probably damaging 1.00
R5488:Nlrp5 UTSW 7 23417934 missense probably benign 0.03
R5762:Nlrp5 UTSW 7 23418839 missense possibly damaging 0.89
R6014:Nlrp5 UTSW 7 23409947 missense probably benign 0.02
R6130:Nlrp5 UTSW 7 23404173 missense probably benign 0.00
R6277:Nlrp5 UTSW 7 23421455 missense probably damaging 1.00
R6509:Nlrp5 UTSW 7 23417916 missense probably damaging 1.00
R6519:Nlrp5 UTSW 7 23417918 missense probably benign 0.22
R7042:Nlrp5 UTSW 7 23417480 missense possibly damaging 0.52
R7253:Nlrp5 UTSW 7 23417391 missense possibly damaging 0.93
R7336:Nlrp5 UTSW 7 23417634 missense probably damaging 0.98
R7371:Nlrp5 UTSW 7 23418423 missense probably damaging 0.99
R7449:Nlrp5 UTSW 7 23417526 missense probably benign 0.00
R7505:Nlrp5 UTSW 7 23407500 missense probably benign 0.01
R7580:Nlrp5 UTSW 7 23433749 missense probably damaging 1.00
R7588:Nlrp5 UTSW 7 23408151 missense probably benign 0.21
R7793:Nlrp5 UTSW 7 23423918 missense possibly damaging 0.87
R7795:Nlrp5 UTSW 7 23418794 missense possibly damaging 0.78
RF007:Nlrp5 UTSW 7 23418161 missense probably benign 0.16
U24488:Nlrp5 UTSW 7 23418228 missense possibly damaging 0.94
X0026:Nlrp5 UTSW 7 23417498 nonsense probably null
X0062:Nlrp5 UTSW 7 23417990 nonsense probably null
Z1088:Nlrp5 UTSW 7 23404167 missense possibly damaging 0.82
Z1088:Nlrp5 UTSW 7 23417586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCTTTGGCCAGAAGTATTG -3'
(R):5'- TGCAGACAGTCCTTCAACCAG -3'

Sequencing Primer
(F):5'- GCCAGAAGTATTGTTCTTGGC -3'
(R):5'- CAGTCCTTCAACCAGTATATAGAGGG -3'
Posted On2016-02-04