Mutagenetix > Incidental Mutation

Incidental Mutation 'R4793:Lrriq1'

368783

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R4793 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103170466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1266 (D1266G)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably benign
Transcript: ENSMUST00000166240
AA Change: D1266G

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: D1266G

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

100% (91/91)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	A	11: 110,191,718	E1143V	probably benign	Het
Abi2	T	A	1: 60,409,804	M1K	probably null	Het
Acp2	T	C	2: 91,206,789	F205L	probably benign	Het
Adam17	T	C	12: 21,347,395	N219D	probably benign	Het
Aldh2	T	C	5: 121,568,979	S168G	probably damaging	Het
Arhgap15	A	T	2: 44,142,341	E312D	probably damaging	Het
BC017158	A	T	7: 128,288,202		probably benign	Het
Calm5	T	C	13: 3,854,401	S32P	probably benign	Het
Capn12	G	A	7: 28,892,669	D671N	probably benign	Het
Ccdc73	A	G	2: 105,017,782		probably null	Het
Cdc20	T	A	4: 118,437,064	I20F	probably benign	Het
Cdh23	A	T	10: 60,331,350	I1841N	probably damaging	Het
Cftr	T	C	6: 18,226,088	V345A	probably damaging	Het
Col15a1	T	C	4: 47,262,997	S550P	possibly damaging	Het
Col4a4	A	G	1: 82,539,099	Y133H	unknown	Het
Csmd1	A	G	8: 16,088,263	S1592P	probably damaging	Het
Cts6	T	A	13: 61,201,812	M56L	probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Diexf	T	A	1: 193,113,808	Q50L	probably null	Het
Dock5	A	G	14: 67,800,354	S947P	probably benign	Het
Dpysl2	G	T	14: 66,815,049	A339D	possibly damaging	Het
Ebf2	A	G	14: 67,410,082	D360G	probably damaging	Het
Ensa	T	C	3: 95,625,178		probably null	Het
Fap	C	A	2: 62,544,369	V229F	probably damaging	Het
Fbn1	C	A	2: 125,321,235	G2116*	probably null	Het
Frmd4b	A	T	6: 97,295,861	S857T	probably damaging	Het
Fsip2	T	A	2: 82,987,700	Y4592*	probably null	Het
Fubp1	T	A	3: 152,223,329	Y135N	possibly damaging	Het
Gdap2	T	C	3: 100,170,918	L66P	probably damaging	Het
Gm10257	T	C	13: 100,946,797		noncoding transcript	Het
Gm1758	A	T	16: 14,507,172		noncoding transcript	Het
Gna13	T	C	11: 109,363,629		probably benign	Het
Heatr1	T	C	13: 12,431,837	I1689T	probably benign	Het
Hephl1	A	G	9: 15,097,990	I102T	probably benign	Het
Hist1h2bl	T	C	13: 21,715,918	S76G	probably benign	Het
Hltf	T	G	3: 20,063,950	Y121D	possibly damaging	Het
Hspg2	T	C	4: 137,529,473	V1509A	possibly damaging	Het
Ifitm5	G	T	7: 140,950,164	R16S	probably benign	Het
Il1rap	A	C	16: 26,695,234	D239A	probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kcna6	T	C	6: 126,738,556	I457V	probably damaging	Het
Kctd17	T	A	15: 78,433,024	L47Q	probably damaging	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrrc63	A	G	14: 75,126,161	S177P	possibly damaging	Het
Map3k2	G	T	18: 32,228,150	M554I	probably damaging	Het
Mettl7a3	A	G	15: 100,335,008	M27V	probably benign	Het
Mst1r	T	A	9: 107,919,925	V1331E	probably damaging	Het
Musk	T	C	4: 58,373,400	I775T	probably damaging	Het
Mybl2	A	G	2: 163,074,763	K7E	probably damaging	Het
Nf1	T	C	11: 79,447,572	S1137P	probably damaging	Het
Nlrp5	A	G	7: 23,417,630	I260V	probably damaging	Het
Olfr1006	A	C	2: 85,674,498	Y218D	probably damaging	Het
Olfr1413	G	T	1: 92,573,485	A105S	possibly damaging	Het
Olfr155	A	T	4: 43,854,323	N5Y	probably benign	Het
Pabpc1l	C	T	2: 164,027,622	A114V	possibly damaging	Het
Plac8l1	T	A	18: 42,178,908	I149F	possibly damaging	Het
Pou6f1	T	A	15: 100,578,412	N531I	probably damaging	Het
Prdm10	A	G	9: 31,353,405	Y712C	probably damaging	Het
Ptbp3	T	C	4: 59,514,297	T43A	possibly damaging	Het
Ptpn13	T	C	5: 103,582,778		probably null	Het
Rnf135	T	C	11: 80,196,949		probably null	Het
Serpinb3d	A	G	1: 107,078,221	L379P	probably damaging	Het
Sh2d6	T	A	6: 72,517,598	T124S	probably benign	Het
Slc26a5	G	A	5: 21,837,994	P153S	probably damaging	Het
Slc5a7	A	G	17: 54,281,794	F275S	possibly damaging	Het
Snx14	A	G	9: 88,394,442	S606P	probably damaging	Het
Sphkap	A	T	1: 83,278,084	I648K	possibly damaging	Het
Spon2	T	C	5: 33,214,560	T301A	probably damaging	Het
Srpr	C	T	9: 35,213,151	T48I	probably benign	Het
Taar9	G	A	10: 24,109,510	P9S	probably benign	Het
Tacc1	A	T	8: 25,182,389	S274R	possibly damaging	Het
Tc2n	A	G	12: 101,651,117	S348P	possibly damaging	Het
Timd2	G	T	11: 46,687,181	T41K	probably damaging	Het
Tmem132a	T	A	19: 10,865,493	E206V	probably damaging	Het
Tpi1	A	T	6: 124,812,581		probably benign	Het
Traf5	T	G	1: 191,997,804	T429P	probably benign	Het
Trav4-3	A	G	14: 53,599,158	S27G	possibly damaging	Het
Tubd1	T	C	11: 86,567,069	M462T	probably benign	Het
Ube4a	T	C	9: 44,948,822	D314G	probably damaging	Het
Vmn2r58	G	T	7: 41,865,071	T158K	probably damaging	Het
Vmn2r68	C	A	7: 85,234,440	M152I	probably benign	Het
Vmn2r91	A	G	17: 18,105,396	E92G	probably damaging	Het
Wdr20rt	T	C	12: 65,226,621	V113A	probably damaging	Het
Zfp729a	T	C	13: 67,620,427	H561R	probably damaging	Het
Zfp804a	T	A	2: 82,235,842	D52E	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCGCAGTGAAAGACATTGAC -3'
(R):5'- AGTTGTGAGGCCGATTCAC -3'

Sequencing Primer
(F):5'- CGCAGTGAAAGACATTGACACTAG -3'
(R):5'- TGAGGCCGATTCACCAGCC -3'

Posted On

2016-02-04