Incidental Mutation 'R4793:Kalrn'
ID368810
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R4793 (G1)
Quality Score215
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33989810 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2525 (D2525N)
Ref Sequence ENSEMBL: ENSMUSP00000076088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114973]
PDB Structure
Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076810
AA Change: D2525N

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: D2525N

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114973
AA Change: D856N

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: D856N

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,191,718 E1143V probably benign Het
Abi2 T A 1: 60,409,804 M1K probably null Het
Acp2 T C 2: 91,206,789 F205L probably benign Het
Adam17 T C 12: 21,347,395 N219D probably benign Het
Aldh2 T C 5: 121,568,979 S168G probably damaging Het
Arhgap15 A T 2: 44,142,341 E312D probably damaging Het
BC017158 A T 7: 128,288,202 probably benign Het
Calm5 T C 13: 3,854,401 S32P probably benign Het
Capn12 G A 7: 28,892,669 D671N probably benign Het
Ccdc73 A G 2: 105,017,782 probably null Het
Cdc20 T A 4: 118,437,064 I20F probably benign Het
Cdh23 A T 10: 60,331,350 I1841N probably damaging Het
Cftr T C 6: 18,226,088 V345A probably damaging Het
Col15a1 T C 4: 47,262,997 S550P possibly damaging Het
Col4a4 A G 1: 82,539,099 Y133H unknown Het
Csmd1 A G 8: 16,088,263 S1592P probably damaging Het
Cts6 T A 13: 61,201,812 M56L probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Diexf T A 1: 193,113,808 Q50L probably null Het
Dock5 A G 14: 67,800,354 S947P probably benign Het
Dpysl2 G T 14: 66,815,049 A339D possibly damaging Het
Ebf2 A G 14: 67,410,082 D360G probably damaging Het
Ensa T C 3: 95,625,178 probably null Het
Fap C A 2: 62,544,369 V229F probably damaging Het
Fbn1 C A 2: 125,321,235 G2116* probably null Het
Frmd4b A T 6: 97,295,861 S857T probably damaging Het
Fsip2 T A 2: 82,987,700 Y4592* probably null Het
Fubp1 T A 3: 152,223,329 Y135N possibly damaging Het
Gdap2 T C 3: 100,170,918 L66P probably damaging Het
Gm10257 T C 13: 100,946,797 noncoding transcript Het
Gm1758 A T 16: 14,507,172 noncoding transcript Het
Gna13 T C 11: 109,363,629 probably benign Het
Heatr1 T C 13: 12,431,837 I1689T probably benign Het
Hephl1 A G 9: 15,097,990 I102T probably benign Het
Hist1h2bl T C 13: 21,715,918 S76G probably benign Het
Hltf T G 3: 20,063,950 Y121D possibly damaging Het
Hspg2 T C 4: 137,529,473 V1509A possibly damaging Het
Ifitm5 G T 7: 140,950,164 R16S probably benign Het
Il1rap A C 16: 26,695,234 D239A probably benign Het
Kcna6 T C 6: 126,738,556 I457V probably damaging Het
Kctd17 T A 15: 78,433,024 L47Q probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc63 A G 14: 75,126,161 S177P possibly damaging Het
Lrriq1 T C 10: 103,170,466 D1266G probably benign Het
Map3k2 G T 18: 32,228,150 M554I probably damaging Het
Mettl7a3 A G 15: 100,335,008 M27V probably benign Het
Mst1r T A 9: 107,919,925 V1331E probably damaging Het
Musk T C 4: 58,373,400 I775T probably damaging Het
Mybl2 A G 2: 163,074,763 K7E probably damaging Het
Nf1 T C 11: 79,447,572 S1137P probably damaging Het
Nlrp5 A G 7: 23,417,630 I260V probably damaging Het
Olfr1006 A C 2: 85,674,498 Y218D probably damaging Het
Olfr1413 G T 1: 92,573,485 A105S possibly damaging Het
Olfr155 A T 4: 43,854,323 N5Y probably benign Het
Pabpc1l C T 2: 164,027,622 A114V possibly damaging Het
Plac8l1 T A 18: 42,178,908 I149F possibly damaging Het
Pou6f1 T A 15: 100,578,412 N531I probably damaging Het
Prdm10 A G 9: 31,353,405 Y712C probably damaging Het
Ptbp3 T C 4: 59,514,297 T43A possibly damaging Het
Ptpn13 T C 5: 103,582,778 probably null Het
Rnf135 T C 11: 80,196,949 probably null Het
Serpinb3d A G 1: 107,078,221 L379P probably damaging Het
Sh2d6 T A 6: 72,517,598 T124S probably benign Het
Slc26a5 G A 5: 21,837,994 P153S probably damaging Het
Slc5a7 A G 17: 54,281,794 F275S possibly damaging Het
Snx14 A G 9: 88,394,442 S606P probably damaging Het
Sphkap A T 1: 83,278,084 I648K possibly damaging Het
Spon2 T C 5: 33,214,560 T301A probably damaging Het
Srpr C T 9: 35,213,151 T48I probably benign Het
Taar9 G A 10: 24,109,510 P9S probably benign Het
Tacc1 A T 8: 25,182,389 S274R possibly damaging Het
Tc2n A G 12: 101,651,117 S348P possibly damaging Het
Timd2 G T 11: 46,687,181 T41K probably damaging Het
Tmem132a T A 19: 10,865,493 E206V probably damaging Het
Tpi1 A T 6: 124,812,581 probably benign Het
Traf5 T G 1: 191,997,804 T429P probably benign Het
Trav4-3 A G 14: 53,599,158 S27G possibly damaging Het
Tubd1 T C 11: 86,567,069 M462T probably benign Het
Ube4a T C 9: 44,948,822 D314G probably damaging Het
Vmn2r58 G T 7: 41,865,071 T158K probably damaging Het
Vmn2r68 C A 7: 85,234,440 M152I probably benign Het
Vmn2r91 A G 17: 18,105,396 E92G probably damaging Het
Wdr20rt T C 12: 65,226,621 V113A probably damaging Het
Zfp729a T C 13: 67,620,427 H561R probably damaging Het
Zfp804a T A 2: 82,235,842 D52E probably damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
R6808_Kalrn_672 UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTAATGTCTTTGAGGCCATAATAGG -3'
(R):5'- CAAGTTGTAGAGCTGGGCTG -3'

Sequencing Primer
(F):5'- CCATAAACTGATGGGTGTGTCC -3'
(R):5'- AGGCACTCCCAGCTCTG -3'
Posted On2016-02-04