Mutagenetix > Incidental Mutation

Incidental Mutation 'R4794:Kif1a'

368818

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

042420-MU

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Essential gene?

Probably essential (E-score: 0.873) question?

Stock #

R4794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93025727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1245 (Y1245C)

Ref Sequence

ENSEMBL: ENSMUSP00000128432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000086819
AA Change: Y1246C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: Y1246C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112958
AA Change: Y1246C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: Y1246C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171556
AA Change: Y1237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: Y1237C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171796
AA Change: Y1245C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: Y1245C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188136

Predicted Effect

probably damaging
Transcript: ENSMUST00000190723
AA Change: Y1339C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: Y1339C

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190854

Meta Mutation Damage Score

0.3043

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,421,424	I141K	probably damaging	Het
Adgrb1	A	G	15: 74,588,129	E537G	probably damaging	Het
Asic3	C	T	5: 24,415,897	A259V	probably damaging	Het
Bcar1	G	A	8: 111,720,920	Q142*	probably null	Het
Bcas3	T	C	11: 85,509,468	V200A	probably damaging	Het
Cd302	A	T	2: 60,272,149	I42N	probably benign	Het
Colec12	C	A	18: 9,848,984	N387K	probably damaging	Het
Copa	T	A	1: 172,119,321	I1032N	probably damaging	Het
D630003M21Rik	G	C	2: 158,196,139	T1129S	probably benign	Het
D630045J12Rik	G	A	6: 38,194,485	T916I	possibly damaging	Het
Dnajb13	C	T	7: 100,503,992	A241T	probably damaging	Het
Dyrk4	G	T	6: 126,885,337	N397K	possibly damaging	Het
Eftud2	T	A	11: 102,870,177	Y114F	probably benign	Het
Epm2a	A	G	10: 11,390,853	D114G	probably benign	Het
Exoc5	T	C	14: 49,048,900		probably null	Het
Fam135a	G	A	1: 24,029,160	T706I	probably benign	Het
Fasn	A	G	11: 120,811,295	V1845A	probably benign	Het
Fscn3	A	G	6: 28,430,596	E255G	probably damaging	Het
Galnt7	A	T	8: 57,545,363	Y311N	probably damaging	Het
Gm13757	A	T	2: 88,446,347	M197K	probably benign	Het
Gm5724	A	G	6: 141,767,562	V31A	probably benign	Het
Gm8765	C	G	13: 50,703,239	P971R	probably benign	Het
Grid1	T	C	14: 34,822,622	L50P	probably damaging	Het
Hepacam2	A	G	6: 3,475,933	F331L	probably damaging	Het
Ikbkap	ACTTCTTCTTCTTCTTCTTCTTC	ACTTCTTCTTCTTCTTCTTC	4: 56,781,176		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Ltbp3	T	C	19: 5,756,679	F1022L	probably damaging	Het
Med16	G	T	10: 79,900,117	T399N	probably damaging	Het
Mfsd14a	A	T	3: 116,645,506		probably benign	Het
Myh7b	G	A	2: 155,623,266	V681I	probably benign	Het
Ndc1	A	G	4: 107,390,222	E409G	probably benign	Het
Necap2	A	G	4: 141,071,601		probably benign	Het
Olfr47	T	A	6: 43,235,695	L29H	probably damaging	Het
Olfr847	C	T	9: 19,375,545	S112N	probably benign	Het
Parp12	G	A	6: 39,117,810	T117I	probably benign	Het
Pars2	C	A	4: 106,654,210	C396*	probably null	Het
Prg4	A	T	1: 150,454,546		probably benign	Het
Prkg2	G	A	5: 98,966,633	T523I	probably damaging	Het
Prph	T	A	15: 99,057,427	L425Q	probably damaging	Het
Ranbp9	A	G	13: 43,414,076	Y549H	probably damaging	Het
Rbm12	A	T	2: 156,095,569		probably benign	Het
Reln	T	C	5: 22,344,185	Y75C	probably damaging	Het
Rock2	G	A	12: 16,940,407	R110H	probably damaging	Het
Samd1	G	A	8: 83,999,717	E468K	probably damaging	Het
Samd11	T	A	4: 156,249,465	Q173L	probably damaging	Het
Scgb2b20	C	A	7: 33,365,726	G37V	probably damaging	Het
Sf1	C	A	19: 6,375,664		probably benign	Het
Slc17a5	T	A	9: 78,574,715	H183L	probably damaging	Het
Smgc	T	A	15: 91,841,454	S13T	probably benign	Het
Snapin	A	G	3: 90,490,785		probably benign	Het
Ssc5d	C	T	7: 4,943,745	P1033S	probably benign	Het
Strn3	T	C	12: 51,650,171	E259G	probably benign	Het
Tbc1d32	A	G	10: 56,196,836	F238L	possibly damaging	Het
Tbck	G	A	3: 132,686,968	V57M	possibly damaging	Het
Tgm3	A	G	2: 130,041,955	D511G	probably benign	Het
Tlr5	T	C	1: 182,973,896	V241A	probably benign	Het
Tmem181c-ps	A	G	17: 6,620,355		noncoding transcript	Het
Tnfrsf1a	G	A	6: 125,358,084	C168Y	probably damaging	Het
Tph2	G	T	10: 115,182,770	L79I	possibly damaging	Het
Tsc1	G	A	2: 28,661,690		probably null	Het
Ttc14	A	T	3: 33,803,149	M215L	probably benign	Het
Ube3c	A	G	5: 29,597,085	N120S	probably benign	Het
Ubr2	A	T	17: 46,930,445	W1728R	probably damaging	Het
Vnn1	A	G	10: 23,900,704	T318A	probably benign	Het
Washc2	T	C	6: 116,258,649	V941A	probably benign	Het
Wdfy3	A	G	5: 101,943,943	V510A	probably damaging	Het
Wdsub1	A	T	2: 59,862,844	V272E	possibly damaging	Het
Xylt1	A	C	7: 117,637,635	D537A	probably benign	Het
Zfp57	A	G	17: 37,010,130	N292S	possibly damaging	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	93066098	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7103:Kif1a	UTSW	1	93077785	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7424:Kif1a	UTSW	1	93054317	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	93051480	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	93055723	missense	probably benign
R9625:Kif1a	UTSW	1	93073044	missense	probably benign	0.42
R9694:Kif1a	UTSW	1	93022451	missense	probably benign
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTCTGAGAAGAGAGTGGGGTC -3'
(R):5'- TGCCAGACAATGAATGGCCC -3'

Sequencing Primer
(F):5'- AGAGTGGGGTCCATGGAC -3'
(R):5'- AATGAATGGCCCCACGGTG -3'

Posted On

2016-02-04