Incidental Mutation 'R4794:Prg4'
ID368819
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Nameproteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
SynonymsDOL54, SZP, lubricin, MSF
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150449412-150466165 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 150454546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973] [ENSMUST00000159035] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000162367] [ENSMUST00000164600]
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111901
AA Change: L536Q
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: L536Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111902
AA Change: L583Q
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: L583Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124484
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152967
Predicted Effect probably benign
Transcript: ENSMUST00000159035
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161611
AA Change: L792Q
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: L792Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000164600
AA Change: L792Q
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: L792Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150451920 missense probably damaging 0.99
IGL02033:Prg4 APN 1 150455868 intron probably benign
IGL02154:Prg4 APN 1 150454862 intron probably benign
IGL03111:Prg4 APN 1 150451902 missense probably benign 0.06
IGL03177:Prg4 APN 1 150455603 intron probably benign
IGL03260:Prg4 APN 1 150455627 intron probably benign
IGL03281:Prg4 APN 1 150450088 splice site probably benign
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150454492 intron probably benign
R0233:Prg4 UTSW 1 150453547 splice site probably benign
R0255:Prg4 UTSW 1 150455807 intron probably benign
R0616:Prg4 UTSW 1 150460711 missense probably damaging 1.00
R1016:Prg4 UTSW 1 150454691 intron probably benign
R1826:Prg4 UTSW 1 150452009 missense probably benign 0.09
R1862:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1863:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1922:Prg4 UTSW 1 150449999 nonsense probably null
R1940:Prg4 UTSW 1 150456023 missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150451371 missense probably damaging 0.97
R3855:Prg4 UTSW 1 150452000 missense probably damaging 1.00
R3894:Prg4 UTSW 1 150454759 intron probably benign
R3895:Prg4 UTSW 1 150454759 intron probably benign
R3912:Prg4 UTSW 1 150451868 missense probably damaging 1.00
R3935:Prg4 UTSW 1 150458157 missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150454759 intron probably benign
R4475:Prg4 UTSW 1 150454859 intron probably benign
R4910:Prg4 UTSW 1 150455823 intron probably benign
R4911:Prg4 UTSW 1 150455823 intron probably benign
R4993:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R5378:Prg4 UTSW 1 150455226 intron probably benign
R5381:Prg4 UTSW 1 150454453 intron probably benign
R5452:Prg4 UTSW 1 150455768 intron probably benign
R5870:Prg4 UTSW 1 150455549 nonsense probably null
R5888:Prg4 UTSW 1 150452350 missense probably damaging 1.00
R5929:Prg4 UTSW 1 150454129 missense probably benign 0.01
R6058:Prg4 UTSW 1 150451446 missense probably damaging 0.99
R6059:Prg4 UTSW 1 150449997 missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150455816 intron probably benign
R6272:Prg4 UTSW 1 150454766 intron probably benign
R6459:Prg4 UTSW 1 150454301 intron probably benign
R6659:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R6663:Prg4 UTSW 1 150455101 intron probably benign
R6882:Prg4 UTSW 1 150453495 missense probably damaging 1.00
R6970:Prg4 UTSW 1 150455906 intron probably benign
R7078:Prg4 UTSW 1 150458263 missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150452254 missense probably damaging 1.00
R7264:Prg4 UTSW 1 150454067 missense not run
R7487:Prg4 UTSW 1 150455905 missense unknown
R7531:Prg4 UTSW 1 150455035 missense unknown
R7651:Prg4 UTSW 1 150454945 missense unknown
R7701:Prg4 UTSW 1 150457542 missense possibly damaging 0.53
X0024:Prg4 UTSW 1 150454492 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTGTTGCTGAAGTCGTC -3'
(R):5'- TCCCAAGGAGCCTGAACCTA -3'

Sequencing Primer
(F):5'- CTGAAGTCGTCTTTAGAGGAGATG -3'
(R):5'- GGAGCCTGAACCTACAACC -3'
Posted On2016-02-04