Mutagenetix > Incidental Mutation

Incidental Mutation 'R4794:Tlr5'

368821

Institutional Source

Beutler Lab

Gene Symbol

Tlr5

Ensembl Gene

ENSMUSG00000079164

Gene Name

toll-like receptor 5

Synonyms

MMRRC Submission

042420-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.335) question?

Stock #

R4794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

182954788-182976044 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 182973896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 241 (V241A)

Ref Sequence

ENSEMBL: ENSMUSP00000141458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110997
AA Change: V255A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: V255A

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	3.11e-2	SMART
LRR	159	183	5.56e0	SMART
LRR	184	207	1.97e2	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	7.05e-1	SMART
LRR	350	373	2.92e1	SMART
LRR	374	397	2.54e1	SMART
LRR	398	418	1.29e2	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	1.06e-4	SMART
LRR	540	563	6.13e-1	SMART
LRR	564	585	2.21e2	SMART
LRRCT	594	645	7.01e-6	SMART
low complexity region	657	676	N/A	INTRINSIC
TIR	707	852	3.89e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191820
AA Change: V241A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: V241A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
LRR_TYP	95	118	1.3e-4	SMART
LRR	145	169	2.3e-2	SMART
LRR	170	193	8.2e-1	SMART
low complexity region	248	261	N/A	INTRINSIC
LRR	312	335	2.9e-3	SMART
LRR	336	359	1.2e-1	SMART
LRR	360	383	1.1e-1	SMART
LRR	384	404	5.4e-1	SMART
low complexity region	427	442	N/A	INTRINSIC
LRR_TYP	502	525	4.5e-7	SMART
LRR	526	549	2.5e-3	SMART
LRR	550	571	9.4e-1	SMART
LRRCT	580	631	3.4e-8	SMART
transmembrane domain	642	664	N/A	INTRINSIC
TIR	693	838	2.5e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193539

Predicted Effect

probably benign
Transcript: ENSMUST00000193687
AA Change: V255A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: V255A

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	1.3e-4	SMART
LRR	159	183	2.3e-2	SMART
LRR	184	207	8.2e-1	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	2.9e-3	SMART
LRR	350	373	1.2e-1	SMART
LRR	374	397	1.1e-1	SMART
LRR	398	418	5.4e-1	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	4.5e-7	SMART
LRR	540	563	2.5e-3	SMART
LRR	564	585	9.4e-1	SMART
LRRCT	594	645	3.4e-8	SMART
transmembrane domain	656	678	N/A	INTRINSIC
TIR	707	852	2.5e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195614

Meta Mutation Damage Score

0.0986

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,421,424	I141K	probably damaging	Het
Adgrb1	A	G	15: 74,588,129	E537G	probably damaging	Het
Asic3	C	T	5: 24,415,897	A259V	probably damaging	Het
Bcar1	G	A	8: 111,720,920	Q142*	probably null	Het
Bcas3	T	C	11: 85,509,468	V200A	probably damaging	Het
Cd302	A	T	2: 60,272,149	I42N	probably benign	Het
Colec12	C	A	18: 9,848,984	N387K	probably damaging	Het
Copa	T	A	1: 172,119,321	I1032N	probably damaging	Het
D630003M21Rik	G	C	2: 158,196,139	T1129S	probably benign	Het
D630045J12Rik	G	A	6: 38,194,485	T916I	possibly damaging	Het
Dnajb13	C	T	7: 100,503,992	A241T	probably damaging	Het
Dyrk4	G	T	6: 126,885,337	N397K	possibly damaging	Het
Eftud2	T	A	11: 102,870,177	Y114F	probably benign	Het
Epm2a	A	G	10: 11,390,853	D114G	probably benign	Het
Exoc5	T	C	14: 49,048,900		probably null	Het
Fam135a	G	A	1: 24,029,160	T706I	probably benign	Het
Fasn	A	G	11: 120,811,295	V1845A	probably benign	Het
Fscn3	A	G	6: 28,430,596	E255G	probably damaging	Het
Galnt7	A	T	8: 57,545,363	Y311N	probably damaging	Het
Gm13757	A	T	2: 88,446,347	M197K	probably benign	Het
Gm5724	A	G	6: 141,767,562	V31A	probably benign	Het
Gm8765	C	G	13: 50,703,239	P971R	probably benign	Het
Grid1	T	C	14: 34,822,622	L50P	probably damaging	Het
Hepacam2	A	G	6: 3,475,933	F331L	probably damaging	Het
Ikbkap	ACTTCTTCTTCTTCTTCTTCTTC	ACTTCTTCTTCTTCTTCTTC	4: 56,781,176		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kif1a	T	C	1: 93,025,727	Y1245C	probably damaging	Het
Ltbp3	T	C	19: 5,756,679	F1022L	probably damaging	Het
Med16	G	T	10: 79,900,117	T399N	probably damaging	Het
Mfsd14a	A	T	3: 116,645,506		probably benign	Het
Myh7b	G	A	2: 155,623,266	V681I	probably benign	Het
Ndc1	A	G	4: 107,390,222	E409G	probably benign	Het
Necap2	A	G	4: 141,071,601		probably benign	Het
Olfr47	T	A	6: 43,235,695	L29H	probably damaging	Het
Olfr847	C	T	9: 19,375,545	S112N	probably benign	Het
Parp12	G	A	6: 39,117,810	T117I	probably benign	Het
Pars2	C	A	4: 106,654,210	C396*	probably null	Het
Prg4	A	T	1: 150,454,546		probably benign	Het
Prkg2	G	A	5: 98,966,633	T523I	probably damaging	Het
Prph	T	A	15: 99,057,427	L425Q	probably damaging	Het
Ranbp9	A	G	13: 43,414,076	Y549H	probably damaging	Het
Rbm12	A	T	2: 156,095,569		probably benign	Het
Reln	T	C	5: 22,344,185	Y75C	probably damaging	Het
Rock2	G	A	12: 16,940,407	R110H	probably damaging	Het
Samd1	G	A	8: 83,999,717	E468K	probably damaging	Het
Samd11	T	A	4: 156,249,465	Q173L	probably damaging	Het
Scgb2b20	C	A	7: 33,365,726	G37V	probably damaging	Het
Sf1	C	A	19: 6,375,664		probably benign	Het
Slc17a5	T	A	9: 78,574,715	H183L	probably damaging	Het
Smgc	T	A	15: 91,841,454	S13T	probably benign	Het
Snapin	A	G	3: 90,490,785		probably benign	Het
Ssc5d	C	T	7: 4,943,745	P1033S	probably benign	Het
Strn3	T	C	12: 51,650,171	E259G	probably benign	Het
Tbc1d32	A	G	10: 56,196,836	F238L	possibly damaging	Het
Tbck	G	A	3: 132,686,968	V57M	possibly damaging	Het
Tgm3	A	G	2: 130,041,955	D511G	probably benign	Het
Tmem181c-ps	A	G	17: 6,620,355		noncoding transcript	Het
Tnfrsf1a	G	A	6: 125,358,084	C168Y	probably damaging	Het
Tph2	G	T	10: 115,182,770	L79I	possibly damaging	Het
Tsc1	G	A	2: 28,661,690		probably null	Het
Ttc14	A	T	3: 33,803,149	M215L	probably benign	Het
Ube3c	A	G	5: 29,597,085	N120S	probably benign	Het
Ubr2	A	T	17: 46,930,445	W1728R	probably damaging	Het
Vnn1	A	G	10: 23,900,704	T318A	probably benign	Het
Washc2	T	C	6: 116,258,649	V941A	probably benign	Het
Wdfy3	A	G	5: 101,943,943	V510A	probably damaging	Het
Wdsub1	A	T	2: 59,862,844	V272E	possibly damaging	Het
Xylt1	A	C	7: 117,637,635	D537A	probably benign	Het
Zfp57	A	G	17: 37,010,130	N292S	possibly damaging	Het

Other mutations in Tlr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tlr5	APN	1	182973829	missense	probably benign
IGL00940:Tlr5	APN	1	182974196	missense	possibly damaging	0.84
IGL01302:Tlr5	APN	1	182974748	missense	probably benign	0.00
IGL01480:Tlr5	APN	1	182973499	missense	probably benign	0.09
IGL01717:Tlr5	APN	1	182975398	missense	probably damaging	1.00
IGL01896:Tlr5	APN	1	182974879	missense	possibly damaging	0.64
IGL02083:Tlr5	APN	1	182973884	missense	possibly damaging	0.91
IGL02135:Tlr5	APN	1	182973254	missense	possibly damaging	0.82
R0464:Tlr5	UTSW	1	182973710	missense	probably benign	0.01
R0552:Tlr5	UTSW	1	182975696	splice site	probably null
R0556:Tlr5	UTSW	1	182974151	missense	probably damaging	1.00
R0639:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R0670:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R1014:Tlr5	UTSW	1	182975677	missense	probably benign	0.00
R1125:Tlr5	UTSW	1	182973892	missense	probably benign	0.00
R1563:Tlr5	UTSW	1	182975010	missense	probably benign	0.09
R1775:Tlr5	UTSW	1	182973722	missense	probably damaging	0.99
R1793:Tlr5	UTSW	1	182972447	missense	probably benign	0.00
R1991:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R1992:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R2114:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2116:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2225:Tlr5	UTSW	1	182972376	start gained	probably benign
R2265:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2266:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2268:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2882:Tlr5	UTSW	1	182973893	missense	probably damaging	1.00
R3695:Tlr5	UTSW	1	182975347	missense	probably damaging	1.00
R3747:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R3749:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R4084:Tlr5	UTSW	1	182974848	missense	possibly damaging	0.60
R4895:Tlr5	UTSW	1	182974199	missense	probably damaging	1.00
R4964:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R4966:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R5496:Tlr5	UTSW	1	182973632	missense	probably damaging	1.00
R6056:Tlr5	UTSW	1	182974038	missense	possibly damaging	0.76
R6715:Tlr5	UTSW	1	182972659	intron	probably benign
R6825:Tlr5	UTSW	1	182973044	intron	probably benign
R6961:Tlr5	UTSW	1	182973511	nonsense	probably null
R7135:Tlr5	UTSW	1	182975523	missense	possibly damaging	0.87
R7232:Tlr5	UTSW	1	182973499	missense	probably benign	0.09
R7255:Tlr5	UTSW	1	182974316	missense	probably damaging	1.00
R7257:Tlr5	UTSW	1	182974233	nonsense	probably null
R8887:Tlr5	UTSW	1	182973767	missense	probably benign	0.07
R9116:Tlr5	UTSW	1	182974595	missense	probably benign
R9224:Tlr5	UTSW	1	182975128	missense	probably benign	0.10
R9284:Tlr5	UTSW	1	182973812	missense	probably benign	0.00
Z1177:Tlr5	UTSW	1	182973817	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATTCTTCATTCCGGGAACTGAATTC -3'
(R):5'- GAAAGGTCCAGTTGCAGCAC -3'

Sequencing Primer
(F):5'- GAACTGAATTCCTTAAGCGACG -3'
(R):5'- AGTTGCAGCACCGAACTTCTG -3'

Posted On

2016-02-04