Incidental Mutation 'R4794:Tgm3'
ID368826
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130041955 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 511 (D511G)
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably benign
Transcript: ENSMUST00000110299
AA Change: D511G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: D511G

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Meta Mutation Damage Score 0.0734 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCTTTGGACAAACTCAAACC -3'
(R):5'- AGGCTGTTCACTACTCTGCC -3'

Sequencing Primer
(F):5'- TCAAACCTAACGCATCTTTCGG -3'
(R):5'- CAGTAGGATCCCATCAGTGAGC -3'
Posted On2016-02-04