Mutagenetix > Incidental Mutations

Incidental Mutation 'R4794:Tgm3'

368826

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

TG E

MMRRC Submission

042420-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130012349-130050399 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130041955 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 511 (D511G)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

Predicted Effect

probably benign
Transcript: ENSMUST00000110299
AA Change: D511G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: D511G

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Meta Mutation Damage Score

0.0734

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,421,424	I141K	probably damaging	Het
Adgrb1	A	G	15: 74,588,129	E537G	probably damaging	Het
Asic3	C	T	5: 24,415,897	A259V	probably damaging	Het
Bcar1	G	A	8: 111,720,920	Q142*	probably null	Het
Bcas3	T	C	11: 85,509,468	V200A	probably damaging	Het
Cd302	A	T	2: 60,272,149	I42N	probably benign	Het
Colec12	C	A	18: 9,848,984	N387K	probably damaging	Het
Copa	T	A	1: 172,119,321	I1032N	probably damaging	Het
D630003M21Rik	G	C	2: 158,196,139	T1129S	probably benign	Het
D630045J12Rik	G	A	6: 38,194,485	T916I	possibly damaging	Het
Dnajb13	C	T	7: 100,503,992	A241T	probably damaging	Het
Dyrk4	G	T	6: 126,885,337	N397K	possibly damaging	Het
Eftud2	T	A	11: 102,870,177	Y114F	probably benign	Het
Epm2a	A	G	10: 11,390,853	D114G	probably benign	Het
Exoc5	T	C	14: 49,048,900		probably null	Het
Fam135a	G	A	1: 24,029,160	T706I	probably benign	Het
Fasn	A	G	11: 120,811,295	V1845A	probably benign	Het
Fscn3	A	G	6: 28,430,596	E255G	probably damaging	Het
Galnt7	A	T	8: 57,545,363	Y311N	probably damaging	Het
Gm13757	A	T	2: 88,446,347	M197K	probably benign	Het
Gm5724	A	G	6: 141,767,562	V31A	probably benign	Het
Gm8765	C	G	13: 50,703,239	P971R	probably benign	Het
Grid1	T	C	14: 34,822,622	L50P	probably damaging	Het
Hepacam2	A	G	6: 3,475,933	F331L	probably damaging	Het
Ikbkap	ACTTCTTCTTCTTCTTCTTCTTC	ACTTCTTCTTCTTCTTCTTC	4: 56,781,176		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kif1a	T	C	1: 93,025,727	Y1245C	probably damaging	Het
Ltbp3	T	C	19: 5,756,679	F1022L	probably damaging	Het
Med16	G	T	10: 79,900,117	T399N	probably damaging	Het
Mfsd14a	A	T	3: 116,645,506		probably benign	Het
Myh7b	G	A	2: 155,623,266	V681I	probably benign	Het
Ndc1	A	G	4: 107,390,222	E409G	probably benign	Het
Necap2	A	G	4: 141,071,601		probably benign	Het
Olfr47	T	A	6: 43,235,695	L29H	probably damaging	Het
Olfr847	C	T	9: 19,375,545	S112N	probably benign	Het
Parp12	G	A	6: 39,117,810	T117I	probably benign	Het
Pars2	C	A	4: 106,654,210	C396*	probably null	Het
Prg4	A	T	1: 150,454,546		probably benign	Het
Prkg2	G	A	5: 98,966,633	T523I	probably damaging	Het
Prph	T	A	15: 99,057,427	L425Q	probably damaging	Het
Ranbp9	A	G	13: 43,414,076	Y549H	probably damaging	Het
Rbm12	A	T	2: 156,095,569		probably benign	Het
Reln	T	C	5: 22,344,185	Y75C	probably damaging	Het
Rock2	G	A	12: 16,940,407	R110H	probably damaging	Het
Samd1	G	A	8: 83,999,717	E468K	probably damaging	Het
Samd11	T	A	4: 156,249,465	Q173L	probably damaging	Het
Scgb2b20	C	A	7: 33,365,726	G37V	probably damaging	Het
Sf1	C	A	19: 6,375,664		probably benign	Het
Slc17a5	T	A	9: 78,574,715	H183L	probably damaging	Het
Smgc	T	A	15: 91,841,454	S13T	probably benign	Het
Snapin	A	G	3: 90,490,785		probably benign	Het
Ssc5d	C	T	7: 4,943,745	P1033S	probably benign	Het
Strn3	T	C	12: 51,650,171	E259G	probably benign	Het
Tbc1d32	A	G	10: 56,196,836	F238L	possibly damaging	Het
Tbck	G	A	3: 132,686,968	V57M	possibly damaging	Het
Tlr5	T	C	1: 182,973,896	V241A	probably benign	Het
Tmem181c-ps	A	G	17: 6,620,355		noncoding transcript	Het
Tnfrsf1a	G	A	6: 125,358,084	C168Y	probably damaging	Het
Tph2	G	T	10: 115,182,770	L79I	possibly damaging	Het
Tsc1	G	A	2: 28,661,690		probably null	Het
Ttc14	A	T	3: 33,803,149	M215L	probably benign	Het
Ube3c	A	G	5: 29,597,085	N120S	probably benign	Het
Ubr2	A	T	17: 46,930,445	W1728R	probably damaging	Het
Vnn1	A	G	10: 23,900,704	T318A	probably benign	Het
Washc2	T	C	6: 116,258,649	V941A	probably benign	Het
Wdfy3	A	G	5: 101,943,943	V510A	probably damaging	Het
Wdsub1	A	T	2: 59,862,844	V272E	possibly damaging	Het
Xylt1	A	C	7: 117,637,635	D537A	probably benign	Het
Zfp57	A	G	17: 37,010,130	N292S	possibly damaging	Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	130038413	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	130038374	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	130024494	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	130044568	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	130047740	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	130024518	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	130030041	splice site	probably null
IGL02449:Tgm3	APN	2	130038609	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	130041979	missense	probably damaging	1.00
tortellini	UTSW	2	130024585	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	130048390	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	130044662	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	130026682	splice site	probably benign
R0834:Tgm3	UTSW	2	130026757	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	130026682	splice site	probably benign
R0940:Tgm3	UTSW	2	130012406	missense	probably benign	0.00
R1354:Tgm3	UTSW	2	130041898	missense	probably benign
R1642:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
R1670:Tgm3	UTSW	2	130041768	nonsense	probably null
R1715:Tgm3	UTSW	2	130026814	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	130029969	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	130037483	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R4231:Tgm3	UTSW	2	130044589	nonsense	probably null
R4296:Tgm3	UTSW	2	130038413	missense	possibly damaging	0.77
R4948:Tgm3	UTSW	2	130048320	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	130037484	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	130048282	missense	possibly damaging	0.95
R5786:Tgm3	UTSW	2	130026784	nonsense	probably null
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	130025301	nonsense	probably null
R6219:Tgm3	UTSW	2	130038610	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	130041970	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	130042029	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	130026777	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	130024561	missense	probably benign	0.00
R7317:Tgm3	UTSW	2	130048291	missense	probably benign	0.09
R7513:Tgm3	UTSW	2	130024404	missense	probably benign	0.00
R7517:Tgm3	UTSW	2	130041764	missense	probably benign	0.01
R7793:Tgm3	UTSW	2	130012410	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	130041899	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	130038480	missense	probably benign
X0065:Tgm3	UTSW	2	130024510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGCTTTGGACAAACTCAAACC -3'
(R):5'- AGGCTGTTCACTACTCTGCC -3'

Sequencing Primer
(F):5'- TCAAACCTAACGCATCTTTCGG -3'
(R):5'- CAGTAGGATCCCATCAGTGAGC -3'

Posted On

2016-02-04