Incidental Mutation 'R4794:Necap2'
ID368837
Institutional Source Beutler Lab
Gene Symbol Necap2
Ensembl Gene ENSMUSG00000028923
Gene NameNECAP endocytosis associated 2
Synonyms1110005F07Rik
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141066512-141078357 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 141071601 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030760] [ENSMUST00000153721]
Predicted Effect probably benign
Transcript: ENSMUST00000030760
SMART Domains Protein: ENSMUSP00000030760
Gene: ENSMUSG00000028923

DomainStartEndE-ValueType
Pfam:DUF1681 6 163 1.7e-60 PFAM
low complexity region 181 197 N/A INTRINSIC
low complexity region 249 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152915
Predicted Effect probably benign
Transcript: ENSMUST00000153721
SMART Domains Protein: ENSMUSP00000121918
Gene: ENSMUSG00000028923

DomainStartEndE-ValueType
Pfam:DUF1681 1 75 4.6e-32 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the adaptin-ear-binding coat-associated protein family. Studies of a similar protein in rat suggest a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Necap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Necap2 APN 4 141067568 missense probably damaging 1.00
IGL01339:Necap2 APN 4 141074965 missense probably benign 0.03
IGL02172:Necap2 APN 4 141078310 unclassified probably benign
IGL03323:Necap2 APN 4 141068222 missense possibly damaging 0.89
R4951:Necap2 UTSW 4 141072523 splice site probably null
R6931:Necap2 UTSW 4 141078212 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCACACTGATGGACACAG -3'
(R):5'- ATCTGTACAGAGAAAGTGTGTGACTC -3'

Sequencing Primer
(F):5'- TTGTGACCACAGCAGCAG -3'
(R):5'- GCTTTGGGACCCTGAAG -3'
Posted On2016-02-04