Incidental Mutation 'R4794:Asic3'
ID 368840
Institutional Source Beutler Lab
Gene Symbol Asic3
Ensembl Gene ENSMUSG00000038276
Gene Name acid-sensing (proton-gated) ion channel 3
Synonyms DRASIC, Accn3
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 24413392-24417835 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24415897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 259 (A259V)
Ref Sequence ENSEMBL: ENSMUSP00000143083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030814] [ENSMUST00000049346] [ENSMUST00000196296] [ENSMUST00000198990]
AlphaFold Q6X1Y6
Predicted Effect probably benign
Transcript: ENSMUST00000030814
SMART Domains Protein: ENSMUSP00000030814
Gene: ENSMUSG00000028969

DomainStartEndE-ValueType
S_TKc 4 286 6.11e-101 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049346
AA Change: A259V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039914
Gene: ENSMUSG00000038276
AA Change: A259V

DomainStartEndE-ValueType
Pfam:ASC 21 458 2.5e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196296
AA Change: A259V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143083
Gene: ENSMUSG00000038276
AA Change: A259V

DomainStartEndE-ValueType
Pfam:ASC 21 459 4e-155 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198241
Predicted Effect probably benign
Transcript: ENSMUST00000198442
Predicted Effect probably benign
Transcript: ENSMUST00000198990
SMART Domains Protein: ENSMUSP00000142413
Gene: ENSMUSG00000028969

DomainStartEndE-ValueType
Pfam:Pkinase 4 101 9.7e-23 PFAM
Pfam:Pkinase_Tyr 4 102 2.7e-13 PFAM
Pfam:Pkinase 97 254 6.6e-30 PFAM
Pfam:Pkinase_Tyr 102 200 9.4e-6 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced latency to onset of pain responses, increased sensitivity to light touch, but decreased sensitivity to noxious pinch and responses of acid- and noxious heat-sensitive nociceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Asic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Asic3 APN 5 24417721 missense probably benign 0.44
IGL02527:Asic3 APN 5 24416277 missense probably benign 0.00
IGL02869:Asic3 APN 5 24416974 nonsense probably null
E0370:Asic3 UTSW 5 24413987 missense probably damaging 1.00
IGL03047:Asic3 UTSW 5 24413790 missense probably benign
R0011:Asic3 UTSW 5 24417492 unclassified probably benign
R0011:Asic3 UTSW 5 24417492 unclassified probably benign
R0245:Asic3 UTSW 5 24413838 missense probably damaging 1.00
R0270:Asic3 UTSW 5 24417702 missense probably benign 0.01
R1464:Asic3 UTSW 5 24413821 missense probably damaging 1.00
R1464:Asic3 UTSW 5 24413821 missense probably damaging 1.00
R1702:Asic3 UTSW 5 24415456 missense probably damaging 1.00
R1824:Asic3 UTSW 5 24413751 nonsense probably null
R3403:Asic3 UTSW 5 24416987 missense probably damaging 1.00
R3722:Asic3 UTSW 5 24416999 missense probably benign 0.08
R4383:Asic3 UTSW 5 24413934 missense probably damaging 1.00
R4573:Asic3 UTSW 5 24417192 missense probably damaging 1.00
R6701:Asic3 UTSW 5 24414129 missense possibly damaging 0.65
R7154:Asic3 UTSW 5 24413662 unclassified probably benign
R7569:Asic3 UTSW 5 24414048 missense probably benign 0.00
R7956:Asic3 UTSW 5 24416977 missense possibly damaging 0.61
R9233:Asic3 UTSW 5 24413839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAATCCTGAGGAGAGGGAC -3'
(R):5'- GATCCACAGATGCGGTATTGC -3'

Sequencing Primer
(F):5'- ACTGCCAAGAGAGTCTCTCCTG -3'
(R):5'- TGGCAGGAAACTCAGCTGTC -3'
Posted On 2016-02-04