Incidental Mutation 'R4794:Fscn3'
ID368845
Institutional Source Beutler Lab
Gene Symbol Fscn3
Ensembl Gene ENSMUSG00000029707
Gene Namefascin actin-bundling protein 3
SynonymsOTTMUSP00000023543; fascin (testis); fascin 3
MMRRC Submission 042420-MU
Accession Numbers

Genbank: NM_019569; MGI:1890386

Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location28427789-28438622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28430596 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 255 (E255G)
Ref Sequence ENSEMBL: ENSMUSP00000031719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020717] [ENSMUST00000031719] [ENSMUST00000064377] [ENSMUST00000169841]
Predicted Effect probably benign
Transcript: ENSMUST00000020717
SMART Domains Protein: ENSMUSP00000020717
Gene: ENSMUSG00000020440

DomainStartEndE-ValueType
ARF 1 180 5.83e-121 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000031719
AA Change: E255G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031719
Gene: ENSMUSG00000029707
AA Change: E255G

DomainStartEndE-ValueType
Pfam:Fascin 24 138 1e-29 PFAM
SCOP:d1dfca2 146 260 2e-48 SMART
Pfam:Fascin 271 381 2.1e-26 PFAM
SCOP:d1dfca4 386 498 3e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064377
SMART Domains Protein: ENSMUSP00000067395
Gene: ENSMUSG00000029708

DomainStartEndE-ValueType
coiled coil region 13 61 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
coiled coil region 156 315 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
Blast:H2B 492 590 3e-8 BLAST
low complexity region 613 631 N/A INTRINSIC
coiled coil region 659 701 N/A INTRINSIC
Grip 719 766 8.28e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147036
Predicted Effect probably benign
Transcript: ENSMUST00000169841
SMART Domains Protein: ENSMUSP00000127281
Gene: ENSMUSG00000020440

DomainStartEndE-ValueType
ARF 1 180 5.83e-121 SMART
Meta Mutation Damage Score 0.6026 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Fscn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Fscn3 APN 6 28430506 missense probably benign 0.43
IGL01312:Fscn3 APN 6 28434470 missense probably damaging 0.99
IGL01634:Fscn3 APN 6 28430538 missense probably damaging 1.00
IGL01899:Fscn3 APN 6 28436079 missense probably damaging 1.00
IGL01928:Fscn3 APN 6 28430182 missense possibly damaging 0.65
IGL02334:Fscn3 APN 6 28428154 unclassified probably null
IGL02959:Fscn3 APN 6 28435998 missense possibly damaging 0.93
IGL03201:Fscn3 APN 6 28430605 missense probably benign 0.07
IGL03202:Fscn3 APN 6 28434452 missense probably benign 0.10
IGL03227:Fscn3 APN 6 28434430 missense probably benign 0.00
0152:Fscn3 UTSW 6 28429967 unclassified probably benign
R1478:Fscn3 UTSW 6 28430568 missense probably benign
R1502:Fscn3 UTSW 6 28435623 missense probably benign 0.05
R1955:Fscn3 UTSW 6 28430236 missense possibly damaging 0.82
R2122:Fscn3 UTSW 6 28430389 missense probably benign 0.18
R2135:Fscn3 UTSW 6 28431584 missense probably benign 0.02
R3713:Fscn3 UTSW 6 28428092 missense possibly damaging 0.89
R3715:Fscn3 UTSW 6 28428092 missense possibly damaging 0.89
R3778:Fscn3 UTSW 6 28430032 missense possibly damaging 0.72
R4572:Fscn3 UTSW 6 28430635 unclassified probably null
R4745:Fscn3 UTSW 6 28435628 missense probably damaging 0.98
R4764:Fscn3 UTSW 6 28436201 makesense probably null
R5738:Fscn3 UTSW 6 28430031 missense possibly damaging 0.56
R5951:Fscn3 UTSW 6 28436174 missense possibly damaging 0.88
R5994:Fscn3 UTSW 6 28430295 missense probably benign
R6595:Fscn3 UTSW 6 28430175 missense probably damaging 1.00
R7323:Fscn3 UTSW 6 28431545 missense possibly damaging 0.53
R7738:Fscn3 UTSW 6 28434446 missense probably benign 0.01
R7840:Fscn3 UTSW 6 28430176 missense probably damaging 1.00
R7923:Fscn3 UTSW 6 28430176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGAGGAATGTGGTTTCC -3'
(R):5'- AACTAGGGCACATCCTGAAC -3'

Sequencing Primer
(F):5'- GGATGTTACCATCTGGAGACTTCTAC -3'
(R):5'- TAGGGCACATCCTGAACACAGTTTC -3'
Posted On2016-02-04