Incidental Mutation 'R4794:Dyrk4'
ID 368853
Institutional Source Beutler Lab
Gene Symbol Dyrk4
Ensembl Gene ENSMUSG00000030345
Gene Name dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
Synonyms Dyrk4a, Dyrk4b
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 126876020-126921839 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 126885337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 397 (N397K)
Ref Sequence ENSEMBL: ENSMUSP00000077606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078521] [ENSMUST00000171945]
AlphaFold Q8BI55
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032495
Predicted Effect possibly damaging
Transcript: ENSMUST00000078521
AA Change: N397K

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077606
Gene: ENSMUSG00000030345
AA Change: N397K

DomainStartEndE-ValueType
S_TKc 219 515 2.9e-84 SMART
low complexity region 555 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171945
AA Change: N16K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128180
Gene: ENSMUSG00000030345
AA Change: N16K

DomainStartEndE-ValueType
Pfam:Pkinase 1 59 2.8e-14 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Contrary to expectation, homozygous null males are fertile and do not exhibit any obvious dysfunction in spermatogenesis, sperm motility and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Dyrk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02474:Dyrk4 APN 6 126880231 missense probably damaging 1.00
IGL02598:Dyrk4 APN 6 126884019 intron probably benign
IGL02697:Dyrk4 APN 6 126899008 missense possibly damaging 0.88
IGL03127:Dyrk4 APN 6 126897171 missense possibly damaging 0.92
IGL03229:Dyrk4 APN 6 126886642 unclassified probably benign
IGL03248:Dyrk4 APN 6 126884053 missense probably benign 0.05
R0597:Dyrk4 UTSW 6 126886649 splice site probably null
R0862:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R0864:Dyrk4 UTSW 6 126877333 missense possibly damaging 0.78
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1470:Dyrk4 UTSW 6 126916374 nonsense probably null
R1645:Dyrk4 UTSW 6 126894793 nonsense probably null
R1650:Dyrk4 UTSW 6 126899829 missense probably benign 0.28
R1885:Dyrk4 UTSW 6 126877181 missense probably benign 0.15
R3947:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3948:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R3949:Dyrk4 UTSW 6 126885305 missense probably damaging 1.00
R5991:Dyrk4 UTSW 6 126880225 missense probably benign 0.44
R6143:Dyrk4 UTSW 6 126886651 critical splice donor site probably null
R6269:Dyrk4 UTSW 6 126886727 missense probably damaging 1.00
R6572:Dyrk4 UTSW 6 126897238 missense probably benign
R6598:Dyrk4 UTSW 6 126876326 missense probably benign 0.20
R6703:Dyrk4 UTSW 6 126890082 missense probably damaging 1.00
R6750:Dyrk4 UTSW 6 126898955 missense probably benign 0.00
R7214:Dyrk4 UTSW 6 126885237 missense probably benign 0.35
R7585:Dyrk4 UTSW 6 126890044 missense probably damaging 1.00
R8101:Dyrk4 UTSW 6 126891649 missense possibly damaging 0.87
R8203:Dyrk4 UTSW 6 126894834 missense probably damaging 1.00
R8769:Dyrk4 UTSW 6 126880245 missense possibly damaging 0.49
R8975:Dyrk4 UTSW 6 126894820 missense probably benign 0.00
Z1176:Dyrk4 UTSW 6 126892128 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAATGAACCCCAGAGCCTG -3'
(R):5'- CAGCTGGAAGGACTAGTCTATGGG -3'

Sequencing Primer
(F):5'- CAGAGCCTGAGGATGGATGTTATCC -3'
(R):5'- ACTAGTCTATGGGTAGATGACGC -3'
Posted On 2016-02-04