Mutagenetix > Incidental Mutations

Incidental Mutation 'R4794:Dyrk4'

368853

Institutional Source

Beutler Lab

Gene Symbol

Dyrk4

Ensembl Gene

ENSMUSG00000030345

Gene Name

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4

Synonyms

Dyrk4a, Dyrk4b

MMRRC Submission

042420-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126876020-126921839 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 126885337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 397 (N397K)

Ref Sequence

ENSEMBL: ENSMUSP00000077606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078521] [ENSMUST00000171945]

AlphaFold

Q8BI55

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000032495

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078521
AA Change: N397K

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077606
Gene: ENSMUSG00000030345
AA Change: N397K

Domain	Start	End	E-Value	Type
S_TKc	219	515	2.9e-84	SMART
low complexity region	555	573	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171945
AA Change: N16K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000128180
Gene: ENSMUSG00000030345
AA Change: N16K

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	59	2.8e-14	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to a conserved family of serine/threonine protein kinases. Members of this dual specificity kinase family are thought to function in the regulation of cell differentiation and proliferation, survival, and in development. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Contrary to expectation, homozygous null males are fertile and do not exhibit any obvious dysfunction in spermatogenesis, sperm motility and fertilization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,421,424	I141K	probably damaging	Het
Adgrb1	A	G	15: 74,588,129	E537G	probably damaging	Het
Asic3	C	T	5: 24,415,897	A259V	probably damaging	Het
Bcar1	G	A	8: 111,720,920	Q142*	probably null	Het
Bcas3	T	C	11: 85,509,468	V200A	probably damaging	Het
Cd302	A	T	2: 60,272,149	I42N	probably benign	Het
Colec12	C	A	18: 9,848,984	N387K	probably damaging	Het
Copa	T	A	1: 172,119,321	I1032N	probably damaging	Het
D630003M21Rik	G	C	2: 158,196,139	T1129S	probably benign	Het
D630045J12Rik	G	A	6: 38,194,485	T916I	possibly damaging	Het
Dnajb13	C	T	7: 100,503,992	A241T	probably damaging	Het
Eftud2	T	A	11: 102,870,177	Y114F	probably benign	Het
Epm2a	A	G	10: 11,390,853	D114G	probably benign	Het
Exoc5	T	C	14: 49,048,900		probably null	Het
Fam135a	G	A	1: 24,029,160	T706I	probably benign	Het
Fasn	A	G	11: 120,811,295	V1845A	probably benign	Het
Fscn3	A	G	6: 28,430,596	E255G	probably damaging	Het
Galnt7	A	T	8: 57,545,363	Y311N	probably damaging	Het
Gm13757	A	T	2: 88,446,347	M197K	probably benign	Het
Gm5724	A	G	6: 141,767,562	V31A	probably benign	Het
Gm8765	C	G	13: 50,703,239	P971R	probably benign	Het
Grid1	T	C	14: 34,822,622	L50P	probably damaging	Het
Hepacam2	A	G	6: 3,475,933	F331L	probably damaging	Het
Ikbkap	ACTTCTTCTTCTTCTTCTTCTTC	ACTTCTTCTTCTTCTTCTTC	4: 56,781,176		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kif1a	T	C	1: 93,025,727	Y1245C	probably damaging	Het
Ltbp3	T	C	19: 5,756,679	F1022L	probably damaging	Het
Med16	G	T	10: 79,900,117	T399N	probably damaging	Het
Mfsd14a	A	T	3: 116,645,506		probably benign	Het
Myh7b	G	A	2: 155,623,266	V681I	probably benign	Het
Ndc1	A	G	4: 107,390,222	E409G	probably benign	Het
Necap2	A	G	4: 141,071,601		probably benign	Het
Olfr47	T	A	6: 43,235,695	L29H	probably damaging	Het
Olfr847	C	T	9: 19,375,545	S112N	probably benign	Het
Parp12	G	A	6: 39,117,810	T117I	probably benign	Het
Pars2	C	A	4: 106,654,210	C396*	probably null	Het
Prg4	A	T	1: 150,454,546		probably benign	Het
Prkg2	G	A	5: 98,966,633	T523I	probably damaging	Het
Prph	T	A	15: 99,057,427	L425Q	probably damaging	Het
Ranbp9	A	G	13: 43,414,076	Y549H	probably damaging	Het
Rbm12	A	T	2: 156,095,569		probably benign	Het
Reln	T	C	5: 22,344,185	Y75C	probably damaging	Het
Rock2	G	A	12: 16,940,407	R110H	probably damaging	Het
Samd1	G	A	8: 83,999,717	E468K	probably damaging	Het
Samd11	T	A	4: 156,249,465	Q173L	probably damaging	Het
Scgb2b20	C	A	7: 33,365,726	G37V	probably damaging	Het
Sf1	C	A	19: 6,375,664		probably benign	Het
Slc17a5	T	A	9: 78,574,715	H183L	probably damaging	Het
Smgc	T	A	15: 91,841,454	S13T	probably benign	Het
Snapin	A	G	3: 90,490,785		probably benign	Het
Ssc5d	C	T	7: 4,943,745	P1033S	probably benign	Het
Strn3	T	C	12: 51,650,171	E259G	probably benign	Het
Tbc1d32	A	G	10: 56,196,836	F238L	possibly damaging	Het
Tbck	G	A	3: 132,686,968	V57M	possibly damaging	Het
Tgm3	A	G	2: 130,041,955	D511G	probably benign	Het
Tlr5	T	C	1: 182,973,896	V241A	probably benign	Het
Tmem181c-ps	A	G	17: 6,620,355		noncoding transcript	Het
Tnfrsf1a	G	A	6: 125,358,084	C168Y	probably damaging	Het
Tph2	G	T	10: 115,182,770	L79I	possibly damaging	Het
Tsc1	G	A	2: 28,661,690		probably null	Het
Ttc14	A	T	3: 33,803,149	M215L	probably benign	Het
Ube3c	A	G	5: 29,597,085	N120S	probably benign	Het
Ubr2	A	T	17: 46,930,445	W1728R	probably damaging	Het
Vnn1	A	G	10: 23,900,704	T318A	probably benign	Het
Washc2	T	C	6: 116,258,649	V941A	probably benign	Het
Wdfy3	A	G	5: 101,943,943	V510A	probably damaging	Het
Wdsub1	A	T	2: 59,862,844	V272E	possibly damaging	Het
Xylt1	A	C	7: 117,637,635	D537A	probably benign	Het
Zfp57	A	G	17: 37,010,130	N292S	possibly damaging	Het

Other mutations in Dyrk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02474:Dyrk4	APN	6	126880231	missense	probably damaging	1.00
IGL02598:Dyrk4	APN	6	126884019	intron	probably benign
IGL02697:Dyrk4	APN	6	126899008	missense	possibly damaging	0.88
IGL03127:Dyrk4	APN	6	126897171	missense	possibly damaging	0.92
IGL03229:Dyrk4	APN	6	126886642	unclassified	probably benign
IGL03248:Dyrk4	APN	6	126884053	missense	probably benign	0.05
R0597:Dyrk4	UTSW	6	126886649	splice site	probably null
R0862:Dyrk4	UTSW	6	126877333	missense	possibly damaging	0.78
R0864:Dyrk4	UTSW	6	126877333	missense	possibly damaging	0.78
R1470:Dyrk4	UTSW	6	126916374	nonsense	probably null
R1470:Dyrk4	UTSW	6	126916374	nonsense	probably null
R1645:Dyrk4	UTSW	6	126894793	nonsense	probably null
R1650:Dyrk4	UTSW	6	126899829	missense	probably benign	0.28
R1885:Dyrk4	UTSW	6	126877181	missense	probably benign	0.15
R3947:Dyrk4	UTSW	6	126885305	missense	probably damaging	1.00
R3948:Dyrk4	UTSW	6	126885305	missense	probably damaging	1.00
R3949:Dyrk4	UTSW	6	126885305	missense	probably damaging	1.00
R5991:Dyrk4	UTSW	6	126880225	missense	probably benign	0.44
R6143:Dyrk4	UTSW	6	126886651	critical splice donor site	probably null
R6269:Dyrk4	UTSW	6	126886727	missense	probably damaging	1.00
R6572:Dyrk4	UTSW	6	126897238	missense	probably benign
R6598:Dyrk4	UTSW	6	126876326	missense	probably benign	0.20
R6703:Dyrk4	UTSW	6	126890082	missense	probably damaging	1.00
R6750:Dyrk4	UTSW	6	126898955	missense	probably benign	0.00
R7214:Dyrk4	UTSW	6	126885237	missense	probably benign	0.35
R7585:Dyrk4	UTSW	6	126890044	missense	probably damaging	1.00
R8101:Dyrk4	UTSW	6	126891649	missense	possibly damaging	0.87
R8203:Dyrk4	UTSW	6	126894834	missense	probably damaging	1.00
R8769:Dyrk4	UTSW	6	126880245	missense	possibly damaging	0.49
R8975:Dyrk4	UTSW	6	126894820	missense	probably benign	0.00
Z1176:Dyrk4	UTSW	6	126892128	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAATGAACCCCAGAGCCTG -3'
(R):5'- CAGCTGGAAGGACTAGTCTATGGG -3'

Sequencing Primer
(F):5'- CAGAGCCTGAGGATGGATGTTATCC -3'
(R):5'- ACTAGTCTATGGGTAGATGACGC -3'

Posted On

2016-02-04