Incidental Mutation 'R0418:Suox'
ID36886
Institutional Source Beutler Lab
Gene Symbol Suox
Ensembl Gene ENSMUSG00000049858
Gene Namesulfite oxidase
Synonyms
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128669894-128674073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128670885 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 425 (P425S)
Ref Sequence ENSEMBL: ENSMUSP00000056195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054764]
Predicted Effect probably damaging
Transcript: ENSMUST00000054764
AA Change: P425S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056195
Gene: ENSMUSG00000049858
AA Change: P425S

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Cyt-b5 86 162 3.41e-13 SMART
Pfam:Oxidored_molyb 220 396 1.2e-62 PFAM
Pfam:Mo-co_dimer 418 545 1.7e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217817
Meta Mutation Damage Score 0.5204 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Suox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Suox APN 10 128672098 splice site probably benign
IGL02744:Suox APN 10 128671217 missense probably benign 0.00
PIT4402001:Suox UTSW 10 128671295 missense probably damaging 1.00
R0414:Suox UTSW 10 128671457 missense probably benign 0.01
R0612:Suox UTSW 10 128670656 missense probably benign
R1845:Suox UTSW 10 128670539 missense possibly damaging 0.56
R3976:Suox UTSW 10 128671037 missense probably damaging 0.96
R4808:Suox UTSW 10 128671889 missense possibly damaging 0.81
R5098:Suox UTSW 10 128671158 missense probably damaging 1.00
R5587:Suox UTSW 10 128671825 missense probably damaging 1.00
R5721:Suox UTSW 10 128671293 missense possibly damaging 0.55
R6968:Suox UTSW 10 128671833 missense possibly damaging 0.92
R7378:Suox UTSW 10 128671041 missense probably benign 0.05
R7669:Suox UTSW 10 128670911 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGTCTGGCTGCACATTGTAACTG -3'
(R):5'- TGCCCGTCATGTCAAATGGCTC -3'

Sequencing Primer
(F):5'- GGCACCTGAGCTTTCAACTG -3'
(R):5'- CATGTCAAATGGCTCGGCAG -3'
Posted On2013-05-09