Incidental Mutation 'R4794:Slc17a5'
ID368861
Institutional Source Beutler Lab
Gene Symbol Slc17a5
Ensembl Gene ENSMUSG00000049624
Gene Namesolute carrier family 17 (anion/sugar transporter), member 5
Synonyms4631416G20Rik
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location78536488-78588041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78574715 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 183 (H183L)
Ref Sequence ENSEMBL: ENSMUSP00000056182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052441] [ENSMUST00000117645]
Predicted Effect probably damaging
Transcript: ENSMUST00000052441
AA Change: H183L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056182
Gene: ENSMUSG00000049624
AA Change: H183L

DomainStartEndE-ValueType
Pfam:MFS_1 46 441 1.8e-61 PFAM
transmembrane domain 456 478 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117645
AA Change: H157L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113003
Gene: ENSMUSG00000049624
AA Change: H157L

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Pfam:MFS_1 97 415 2.5e-50 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119213
SMART Domains Protein: ENSMUSP00000113340
Gene: ENSMUSG00000049624

DomainStartEndE-ValueType
Pfam:Sugar_tr 43 175 4.9e-8 PFAM
Pfam:MFS_1 45 189 5.5e-16 PFAM
Meta Mutation Damage Score 0.6226 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane transporter that exports free sialic acids that have been cleaved off of cell surface lipids and proteins from lysosomes. Mutations in this gene cause sialic acid storage diseases, including infantile sialic acid storage disorder and and Salla disease, an adult form. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit numerous neurological abnormalities, including impaired exploratory and locomotor activity, hearing deficits, and an increased depressive-like response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Slc17a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc17a5 APN 9 78578534 missense probably benign
IGL00828:Slc17a5 APN 9 78578551 missense probably benign 0.37
IGL01603:Slc17a5 APN 9 78574707 missense probably damaging 1.00
IGL01945:Slc17a5 APN 9 78587932 missense probably benign 0.01
IGL03250:Slc17a5 APN 9 78578564 missense probably damaging 0.99
PIT4618001:Slc17a5 UTSW 9 78538248 missense possibly damaging 0.52
R0136:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0245:Slc17a5 UTSW 9 78540924 missense probably benign 0.00
R0305:Slc17a5 UTSW 9 78557537 missense probably benign 0.25
R0481:Slc17a5 UTSW 9 78538302 splice site probably null
R0657:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0763:Slc17a5 UTSW 9 78553090 splice site probably benign
R1543:Slc17a5 UTSW 9 78560800 missense probably benign 0.01
R1564:Slc17a5 UTSW 9 78578699 missense probably damaging 0.98
R2155:Slc17a5 UTSW 9 78577173 missense probably damaging 1.00
R2483:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R3623:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R4193:Slc17a5 UTSW 9 78559106 missense possibly damaging 0.58
R5115:Slc17a5 UTSW 9 78577112 missense probably benign 0.12
R5141:Slc17a5 UTSW 9 78540988 missense probably damaging 1.00
R5205:Slc17a5 UTSW 9 78578617 missense probably damaging 1.00
R5953:Slc17a5 UTSW 9 78557498 missense probably damaging 1.00
R6481:Slc17a5 UTSW 9 78538271 missense possibly damaging 0.87
R7375:Slc17a5 UTSW 9 78587892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTTCTCCCAGGAAGAGGC -3'
(R):5'- TTCCTACTGCTGTCACAGAGGG -3'

Sequencing Primer
(F):5'- GGAAGAGGCACCCACACTATC -3'
(R):5'- GGGCCACTGCACTTTTTAATAG -3'
Posted On2016-02-04