Incidental Mutation 'R4794:Tbc1d32'
ID 368865
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, Bromi, b2b2284Clo, C6orf170
MMRRC Submission 042420-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 55890389-56104785 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56072932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 238 (F238L)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099739
AA Change: F238L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: F238L

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,468,198 (GRCm39) I141K probably damaging Het
Adgrb1 A G 15: 74,459,978 (GRCm39) E537G probably damaging Het
Asic3 C T 5: 24,620,895 (GRCm39) A259V probably damaging Het
Bcar1 G A 8: 112,447,552 (GRCm39) Q142* probably null Het
Bcas3 T C 11: 85,400,294 (GRCm39) V200A probably damaging Het
Cd302 A T 2: 60,102,493 (GRCm39) I42N probably benign Het
Colec12 C A 18: 9,848,984 (GRCm39) N387K probably damaging Het
Copa T A 1: 171,946,888 (GRCm39) I1032N probably damaging Het
D630003M21Rik G C 2: 158,038,059 (GRCm39) T1129S probably benign Het
D630045J12Rik G A 6: 38,171,420 (GRCm39) T916I possibly damaging Het
Dnajb13 C T 7: 100,153,199 (GRCm39) A241T probably damaging Het
Dyrk4 G T 6: 126,862,300 (GRCm39) N397K possibly damaging Het
Eftud2 T A 11: 102,761,003 (GRCm39) Y114F probably benign Het
Elp1 ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 (GRCm39) probably benign Het
Epm2a A G 10: 11,266,597 (GRCm39) D114G probably benign Het
Exoc5 T C 14: 49,286,357 (GRCm39) probably null Het
Fam135a G A 1: 24,068,241 (GRCm39) T706I probably benign Het
Fasn A G 11: 120,702,121 (GRCm39) V1845A probably benign Het
Fscn3 A G 6: 28,430,595 (GRCm39) E255G probably damaging Het
Galnt7 A T 8: 57,998,397 (GRCm39) Y311N probably damaging Het
Grid1 T C 14: 34,544,579 (GRCm39) L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 (GRCm39) F331L probably damaging Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Kif1a T C 1: 92,953,449 (GRCm39) Y1245C probably damaging Het
Ltbp3 T C 19: 5,806,707 (GRCm39) F1022L probably damaging Het
Med16 G T 10: 79,735,951 (GRCm39) T399N probably damaging Het
Mfsd14a A T 3: 116,439,155 (GRCm39) probably benign Het
Myh7b G A 2: 155,465,186 (GRCm39) V681I probably benign Het
Ndc1 A G 4: 107,247,419 (GRCm39) E409G probably benign Het
Necap2 A G 4: 140,798,912 (GRCm39) probably benign Het
Or2a57 T A 6: 43,212,629 (GRCm39) L29H probably damaging Het
Or4p21 A T 2: 88,276,691 (GRCm39) M197K probably benign Het
Or7g29 C T 9: 19,286,841 (GRCm39) S112N probably benign Het
Parp12 G A 6: 39,094,744 (GRCm39) T117I probably benign Het
Pars2 C A 4: 106,511,407 (GRCm39) C396* probably null Het
Prg4 A T 1: 150,330,297 (GRCm39) probably benign Het
Prkg2 G A 5: 99,114,492 (GRCm39) T523I probably damaging Het
Prph T A 15: 98,955,308 (GRCm39) L425Q probably damaging Het
Ranbp9 A G 13: 43,567,552 (GRCm39) Y549H probably damaging Het
Rbm12 A T 2: 155,937,489 (GRCm39) probably benign Het
Reln T C 5: 22,549,183 (GRCm39) Y75C probably damaging Het
Rock2 G A 12: 16,990,408 (GRCm39) R110H probably damaging Het
Samd1 G A 8: 84,726,346 (GRCm39) E468K probably damaging Het
Samd11 T A 4: 156,333,922 (GRCm39) Q173L probably damaging Het
Scgb2b20 C A 7: 33,065,151 (GRCm39) G37V probably damaging Het
Sf1 C A 19: 6,425,694 (GRCm39) probably benign Het
Slc17a5 T A 9: 78,481,997 (GRCm39) H183L probably damaging Het
Slco1a7 A G 6: 141,713,288 (GRCm39) V31A probably benign Het
Smgc T A 15: 91,725,657 (GRCm39) S13T probably benign Het
Snapin A G 3: 90,398,092 (GRCm39) probably benign Het
Spata31e4 C G 13: 50,857,275 (GRCm39) P971R probably benign Het
Ssc5d C T 7: 4,946,744 (GRCm39) P1033S probably benign Het
Strn3 T C 12: 51,696,954 (GRCm39) E259G probably benign Het
Tbck G A 3: 132,392,729 (GRCm39) V57M possibly damaging Het
Tgm3 A G 2: 129,883,875 (GRCm39) D511G probably benign Het
Tlr5 T C 1: 182,801,461 (GRCm39) V241A probably benign Het
Tmem181c-ps A G 17: 6,887,754 (GRCm39) noncoding transcript Het
Tnfrsf1a G A 6: 125,335,047 (GRCm39) C168Y probably damaging Het
Tph2 G T 10: 115,018,675 (GRCm39) L79I possibly damaging Het
Tsc1 G A 2: 28,551,702 (GRCm39) probably null Het
Ttc14 A T 3: 33,857,298 (GRCm39) M215L probably benign Het
Ube3c A G 5: 29,802,083 (GRCm39) N120S probably benign Het
Ubr2 A T 17: 47,241,371 (GRCm39) W1728R probably damaging Het
Vnn1 A G 10: 23,776,602 (GRCm39) T318A probably benign Het
Washc2 T C 6: 116,235,610 (GRCm39) V941A probably benign Het
Wdfy3 A G 5: 102,091,809 (GRCm39) V510A probably damaging Het
Wdsub1 A T 2: 59,693,188 (GRCm39) V272E possibly damaging Het
Xylt1 A C 7: 117,236,862 (GRCm39) D537A probably benign Het
Zfp57 A G 17: 37,321,022 (GRCm39) N292S possibly damaging Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56,031,861 (GRCm39) missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56,091,221 (GRCm39) splice site probably benign
IGL00835:Tbc1d32 APN 10 55,965,942 (GRCm39) splice site probably benign
IGL01013:Tbc1d32 APN 10 56,078,055 (GRCm39) splice site probably null
IGL01306:Tbc1d32 APN 10 56,056,620 (GRCm39) missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56,091,176 (GRCm39) missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 55,999,673 (GRCm39) missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56,027,871 (GRCm39) missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 55,964,499 (GRCm39) missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56,100,715 (GRCm39) missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56,074,638 (GRCm39) missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56,074,587 (GRCm39) missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 55,893,799 (GRCm39) missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56,056,620 (GRCm39) missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56,074,535 (GRCm39) missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 55,893,701 (GRCm39) missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56,068,994 (GRCm39) missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56,050,059 (GRCm39) missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56,100,736 (GRCm39) missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56,056,672 (GRCm39) missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56,037,243 (GRCm39) missense probably benign
R1432:Tbc1d32 UTSW 10 55,893,758 (GRCm39) missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56,053,575 (GRCm39) splice site probably benign
R1708:Tbc1d32 UTSW 10 56,027,865 (GRCm39) missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 55,893,700 (GRCm39) missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 55,999,633 (GRCm39) nonsense probably null
R2208:Tbc1d32 UTSW 10 56,026,888 (GRCm39) critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56,050,011 (GRCm39) missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56,005,189 (GRCm39) missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56,100,676 (GRCm39) missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 55,925,867 (GRCm39) missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56,047,000 (GRCm39) missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56,100,745 (GRCm39) missense probably damaging 0.98
R4879:Tbc1d32 UTSW 10 55,925,125 (GRCm39) splice site probably null
R5031:Tbc1d32 UTSW 10 55,999,627 (GRCm39) missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56,071,500 (GRCm39) nonsense probably null
R5276:Tbc1d32 UTSW 10 56,027,914 (GRCm39) missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56,047,033 (GRCm39) missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 55,904,089 (GRCm39) missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 55,916,246 (GRCm39) missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56,071,571 (GRCm39) missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56,005,246 (GRCm39) missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56,026,973 (GRCm39) missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 55,964,489 (GRCm39) missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56,091,158 (GRCm39) missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 55,964,433 (GRCm39) missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56,038,304 (GRCm39) missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56,026,979 (GRCm39) missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56,071,525 (GRCm39) missense probably benign
R6422:Tbc1d32 UTSW 10 55,904,157 (GRCm39) nonsense probably null
R6508:Tbc1d32 UTSW 10 56,100,786 (GRCm39) missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56,056,626 (GRCm39) missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56,027,907 (GRCm39) nonsense probably null
R7012:Tbc1d32 UTSW 10 56,100,820 (GRCm39) missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56,074,537 (GRCm39) missense probably benign
R7288:Tbc1d32 UTSW 10 55,927,483 (GRCm39) critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56,027,929 (GRCm39) missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 55,904,173 (GRCm39) missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56,072,688 (GRCm39) missense possibly damaging 0.93
R8864:Tbc1d32 UTSW 10 55,963,655 (GRCm39) missense probably benign 0.01
R9018:Tbc1d32 UTSW 10 55,948,693 (GRCm39) missense probably benign 0.02
R9030:Tbc1d32 UTSW 10 56,037,241 (GRCm39) missense possibly damaging 0.92
R9530:Tbc1d32 UTSW 10 56,072,507 (GRCm39) missense probably damaging 0.98
R9616:Tbc1d32 UTSW 10 56,037,246 (GRCm39) missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56,046,977 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGTTATGTCTACTCCAGTTG -3'
(R):5'- TGCCCTTTAGAATAGACACGG -3'

Sequencing Primer
(F):5'- TGTCTACTCCAGTTGAAAGAGTAGG -3'
(R):5'- TTTAGAATAGACACGGCCTTCC -3'
Posted On 2016-02-04