Incidental Mutation 'R4794:Med16'
ID 368866
Institutional Source Beutler Lab
Gene Symbol Med16
Ensembl Gene ENSMUSG00000013833
Gene Name mediator complex subunit 16
Synonyms Trap95, 95kDa, Thrap5
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 79894708-79908923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 79900117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 399 (T399N)
Ref Sequence ENSEMBL: ENSMUSP00000129375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000105378
AA Change: T398N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833
AA Change: T398N

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165684
AA Change: T399N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833
AA Change: T399N

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170375
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Med16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Med16 APN 10 79907625 start codon destroyed probably null 0.62
IGL02328:Med16 APN 10 79907542 missense probably damaging 1.00
IGL03123:Med16 APN 10 79896833 missense probably damaging 1.00
R0139:Med16 UTSW 10 79896801 missense probably benign 0.17
R0254:Med16 UTSW 10 79900200 missense possibly damaging 0.94
R1458:Med16 UTSW 10 79907478 unclassified probably benign
R1483:Med16 UTSW 10 79903100 missense possibly damaging 0.88
R1524:Med16 UTSW 10 79898316 missense probably damaging 1.00
R1612:Med16 UTSW 10 79899245 missense probably damaging 1.00
R1700:Med16 UTSW 10 79899335 missense probably benign 0.10
R1900:Med16 UTSW 10 79898931 missense probably damaging 1.00
R1960:Med16 UTSW 10 79907095 missense possibly damaging 0.94
R2120:Med16 UTSW 10 79903082 missense possibly damaging 0.63
R2895:Med16 UTSW 10 79903171 splice site probably null
R4419:Med16 UTSW 10 79898382 missense probably benign
R4970:Med16 UTSW 10 79907037 critical splice donor site probably null
R4975:Med16 UTSW 10 79903005 missense possibly damaging 0.93
R5724:Med16 UTSW 10 79895409 missense probably damaging 1.00
R5926:Med16 UTSW 10 79902528 missense probably damaging 0.99
R6185:Med16 UTSW 10 79896363 missense probably damaging 1.00
R7097:Med16 UTSW 10 79903343 missense probably damaging 1.00
R7346:Med16 UTSW 10 79908816 critical splice donor site probably null
R7350:Med16 UTSW 10 79903197 missense probably damaging 1.00
R7808:Med16 UTSW 10 79898418 missense probably damaging 1.00
R7877:Med16 UTSW 10 79898372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACAGCTCTTTACATATTAAGG -3'
(R):5'- CAGTCCTCTTCCTGAATCGG -3'

Sequencing Primer
(F):5'- GCTCTTTACATATTAAGGAACACAGC -3'
(R):5'- TCTTCCTGAATCGGGGCAG -3'
Posted On 2016-02-04