Incidental Mutation 'R4794:Tph2'
ID368867
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Nametryptophan hydroxylase 2
Synonyms
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R4794 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115078641-115185022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115182770 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 79 (L79I)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006949
AA Change: L79I

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: L79I

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 115079759 nonsense probably null
IGL01989:Tph2 APN 10 115146016 missense probably benign 0.22
IGL02363:Tph2 APN 10 115079981 missense probably benign 0.01
IGL02667:Tph2 APN 10 115080045 missense probably benign 0.43
R0390:Tph2 UTSW 10 115174109 missense probably damaging 1.00
R0400:Tph2 UTSW 10 115080120 splice site probably benign
R0570:Tph2 UTSW 10 115174134 splice site probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1654:Tph2 UTSW 10 115184807 missense probably benign
R3705:Tph2 UTSW 10 115119893 nonsense probably null
R3710:Tph2 UTSW 10 115174058 missense probably benign 0.42
R3777:Tph2 UTSW 10 115080005 missense probably benign
R5015:Tph2 UTSW 10 115079716 missense probably benign 0.01
R5068:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5069:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5070:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5422:Tph2 UTSW 10 115079764 missense possibly damaging 0.94
R5487:Tph2 UTSW 10 115119874 missense probably damaging 1.00
R5604:Tph2 UTSW 10 115090709 missense probably damaging 1.00
R5692:Tph2 UTSW 10 115184827 missense probably damaging 0.97
R6368:Tph2 UTSW 10 115179326 missense probably damaging 1.00
R6802:Tph2 UTSW 10 115184873 missense probably damaging 1.00
R6823:Tph2 UTSW 10 115174106 missense probably benign 0.02
R7371:Tph2 UTSW 10 115151111 missense probably damaging 1.00
R7724:Tph2 UTSW 10 115079822 missense probably benign
R7863:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R8046:Tph2 UTSW 10 115179594 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACCTGCTTATTTCACTGTTGGG -3'
(R):5'- GGCTTGCAGCTTTTAAGAGG -3'

Sequencing Primer
(F):5'- TGTTGGGCAGAGTAAACTCCC -3'
(R):5'- TGAATCATTGAAACCTCTGGGG -3'
Posted On2016-02-04