Incidental Mutation 'R4794:Rock2'
ID368871
Institutional Source Beutler Lab
Gene Symbol Rock2
Ensembl Gene ENSMUSG00000020580
Gene NameRho-associated coiled-coil containing protein kinase 2
SynonymsB230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R4794 (G1)
Quality Score214
Status Validated
Chromosome12
Chromosomal Location16894895-16987823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16940407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 110 (R110H)
Ref Sequence ENSEMBL: ENSMUSP00000152813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]
Predicted Effect probably damaging
Transcript: ENSMUST00000020904
AA Change: R110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: R110H

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220542
Predicted Effect probably damaging
Transcript: ENSMUST00000220688
AA Change: R110H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4141 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Rock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Rock2 APN 12 16978055 missense probably benign 0.11
IGL01565:Rock2 APN 12 16953317 missense possibly damaging 0.62
IGL01637:Rock2 APN 12 16965171 missense probably benign
IGL02164:Rock2 APN 12 16965529 missense probably damaging 1.00
IGL02249:Rock2 APN 12 16971041 unclassified probably benign
IGL02490:Rock2 APN 12 16948563 missense probably damaging 1.00
IGL02815:Rock2 APN 12 16966701 splice site probably benign
IGL02979:Rock2 APN 12 16977940 missense probably benign 0.00
IGL03095:Rock2 APN 12 16953340 missense probably benign 0.00
IGL03198:Rock2 APN 12 16975507 missense probably benign 0.27
R0087:Rock2 UTSW 12 16928966 missense probably benign 0.20
R0189:Rock2 UTSW 12 16959516 splice site probably benign
R0282:Rock2 UTSW 12 16977886 splice site probably benign
R0497:Rock2 UTSW 12 16954953 missense probably benign
R1210:Rock2 UTSW 12 16965469 missense probably damaging 0.96
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1616:Rock2 UTSW 12 16972985 missense probably benign 0.03
R1672:Rock2 UTSW 12 16965652 missense probably benign 0.03
R1815:Rock2 UTSW 12 16972726 missense probably benign 0.01
R1840:Rock2 UTSW 12 16928989 missense probably benign
R2349:Rock2 UTSW 12 16977615 missense probably benign 0.07
R3149:Rock2 UTSW 12 16965091 missense probably damaging 1.00
R3979:Rock2 UTSW 12 16972736 missense probably damaging 1.00
R4030:Rock2 UTSW 12 16975479 missense probably damaging 1.00
R4470:Rock2 UTSW 12 16971275 nonsense probably null
R4492:Rock2 UTSW 12 16977683 missense probably damaging 1.00
R4519:Rock2 UTSW 12 16977737 missense probably damaging 1.00
R4776:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R4908:Rock2 UTSW 12 16959491 missense probably benign 0.00
R5363:Rock2 UTSW 12 16965654 critical splice donor site probably null
R5574:Rock2 UTSW 12 16961641 missense possibly damaging 0.55
R5595:Rock2 UTSW 12 16942809 missense probably damaging 1.00
R6158:Rock2 UTSW 12 16954918 missense probably benign
R6728:Rock2 UTSW 12 16961736 missense probably benign 0.00
R6828:Rock2 UTSW 12 16942959 splice site probably null
R7019:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R7181:Rock2 UTSW 12 16973143 missense probably benign 0.00
R7236:Rock2 UTSW 12 16929002 missense probably damaging 1.00
R7362:Rock2 UTSW 12 16958421 missense probably damaging 1.00
R7593:Rock2 UTSW 12 16958240 missense probably benign 0.00
R7743:Rock2 UTSW 12 16976047 missense probably damaging 1.00
R7782:Rock2 UTSW 12 16971110 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATTTCCTGAAATTTGGGCCCTTAC -3'
(R):5'- CACAAAACAGTCTTCTGAATAGGC -3'

Sequencing Primer
(F):5'- CCTGAAATTTGGGCCCTTACATATG -3'
(R):5'- GTCTTCTGAATAGGCACCTTAACAC -3'
Posted On2016-02-04