Incidental Mutation 'R4794:Adam4'
ID 368873
Institutional Source Beutler Lab
Gene Symbol Adam4
Ensembl Gene ENSMUSG00000072972
Gene Name a disintegrin and metallopeptidase domain 4
Synonyms tMDCV
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 81419443-81421946 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81421424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 141 (I141K)
Ref Sequence ENSEMBL: ENSMUSP00000082427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085319] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold Q8CGQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000085319
AA Change: I141K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082427
Gene: ENSMUSG00000072972
AA Change: I141K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 9e-19 PFAM
Pfam:Reprolysin 213 406 1.3e-16 PFAM
DISIN 429 504 4.89e-37 SMART
ACR 505 648 2.28e-57 SMART
transmembrane domain 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Adam4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Adam4 APN 12 81420649 missense probably damaging 0.96
IGL01133:Adam4 APN 12 81421446 missense possibly damaging 0.53
IGL01636:Adam4 APN 12 81419949 missense possibly damaging 0.81
IGL02133:Adam4 APN 12 81420029 missense probably benign 0.37
IGL02137:Adam4 APN 12 81421103 missense possibly damaging 0.91
IGL02425:Adam4 APN 12 81421328 missense probably benign 0.07
IGL02686:Adam4 APN 12 81421674 missense possibly damaging 0.88
R0554:Adam4 UTSW 12 81421424 missense probably damaging 1.00
R0684:Adam4 UTSW 12 81419654 missense probably damaging 1.00
R1519:Adam4 UTSW 12 81420877 missense possibly damaging 0.67
R1636:Adam4 UTSW 12 81419690 missense probably damaging 0.98
R1795:Adam4 UTSW 12 81421294 missense probably benign 0.03
R1835:Adam4 UTSW 12 81419559 missense probably benign 0.00
R2158:Adam4 UTSW 12 81421763 missense probably damaging 1.00
R2393:Adam4 UTSW 12 81420711 missense probably benign 0.02
R2923:Adam4 UTSW 12 81420744 missense probably damaging 1.00
R3411:Adam4 UTSW 12 81419822 missense possibly damaging 0.64
R4159:Adam4 UTSW 12 81420032 missense probably damaging 0.99
R4509:Adam4 UTSW 12 81421747 nonsense probably null
R4673:Adam4 UTSW 12 81421761 missense possibly damaging 0.56
R5564:Adam4 UTSW 12 81419574 missense probably benign 0.00
R5774:Adam4 UTSW 12 81420686 missense probably damaging 1.00
R6054:Adam4 UTSW 12 81420054 missense probably damaging 0.99
R6722:Adam4 UTSW 12 81421454 missense probably damaging 1.00
R6857:Adam4 UTSW 12 81419949 missense possibly damaging 0.81
R7316:Adam4 UTSW 12 81419724 missense probably benign 0.08
R7393:Adam4 UTSW 12 81419660 missense probably benign 0.01
R7649:Adam4 UTSW 12 81420377 missense probably damaging 1.00
R8245:Adam4 UTSW 12 81419883 missense probably damaging 1.00
R8293:Adam4 UTSW 12 81420411 nonsense probably null
R8729:Adam4 UTSW 12 81421402 nonsense probably null
R8954:Adam4 UTSW 12 81420372 missense possibly damaging 0.90
R9170:Adam4 UTSW 12 81419742 missense probably benign 0.00
R9360:Adam4 UTSW 12 81421487 missense probably damaging 1.00
R9433:Adam4 UTSW 12 81419949 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCAGCTTGGTCTCTTCAGAG -3'
(R):5'- TGTCTGGGCACATCACCTATAG -3'

Sequencing Primer
(F):5'- TCAGAGAGGTCACCTGCCTTTG -3'
(R):5'- TGTGGTCCACATGAAACTCAAG -3'
Posted On 2016-02-04