Incidental Mutation 'R4794:Ranbp9'
ID 368874
Institutional Source Beutler Lab
Gene Symbol Ranbp9
Ensembl Gene ENSMUSG00000038546
Gene Name RAN binding protein 9
Synonyms RanBPM, IBAP-1
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 43402675-43481282 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43414076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 549 (Y549H)
Ref Sequence ENSEMBL: ENSMUSP00000130636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144326] [ENSMUST00000222651]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000144326
AA Change: Y549H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130636
Gene: ENSMUSG00000038546
AA Change: Y549H

DomainStartEndE-ValueType
low complexity region 2 114 N/A INTRINSIC
SPRY 194 315 1.66e-43 SMART
LisH 347 379 6.82e-5 SMART
CTLH 385 442 9.78e-15 SMART
low complexity region 455 478 N/A INTRINSIC
CRA 596 698 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220774
Predicted Effect probably benign
Transcript: ENSMUST00000221092
Predicted Effect possibly damaging
Transcript: ENSMUST00000222651
AA Change: Y385H

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RAN, a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The protein encoded by this gene has also been shown to interact with several other proteins, including met proto-oncogene, homeodomain interacting protein kinase 2, androgen receptor, and cyclin-dependent kinase 11. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial neonatal lethality. Survivors display infertility with impaired spermatogenesis and oogenesis, azoospermia and premature ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Ubr2 A T 17: 46,930,445 W1728R probably damaging Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Ranbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Ranbp9 APN 13 43480504 missense probably damaging 1.00
IGL01478:Ranbp9 APN 13 43414084 missense probably benign 0.31
IGL01948:Ranbp9 APN 13 43422553 missense probably damaging 1.00
IGL02177:Ranbp9 APN 13 43419717 missense probably damaging 0.99
IGL02382:Ranbp9 APN 13 43436146 splice site probably null
R0183:Ranbp9 UTSW 13 43425123 missense probably damaging 1.00
R0401:Ranbp9 UTSW 13 43422658 missense probably damaging 1.00
R0771:Ranbp9 UTSW 13 43461773 missense possibly damaging 0.92
R1551:Ranbp9 UTSW 13 43425117 missense probably benign 0.15
R1644:Ranbp9 UTSW 13 43412539 missense probably damaging 1.00
R1892:Ranbp9 UTSW 13 43416457 missense possibly damaging 0.87
R2247:Ranbp9 UTSW 13 43412425 missense probably damaging 1.00
R4097:Ranbp9 UTSW 13 43421257 missense probably damaging 0.97
R4908:Ranbp9 UTSW 13 43421257 missense possibly damaging 0.81
R4996:Ranbp9 UTSW 13 43425094 nonsense probably null
R5024:Ranbp9 UTSW 13 43434855 missense probably damaging 0.99
R5422:Ranbp9 UTSW 13 43419626 missense probably benign 0.01
R7069:Ranbp9 UTSW 13 43419622 missense probably benign 0.24
R7115:Ranbp9 UTSW 13 43406671 missense probably benign 0.04
R7298:Ranbp9 UTSW 13 43480460 missense probably benign 0.10
R7382:Ranbp9 UTSW 13 43425114 missense probably damaging 0.99
R7826:Ranbp9 UTSW 13 43419621 missense possibly damaging 0.46
R8856:Ranbp9 UTSW 13 43414030 missense probably damaging 1.00
R8914:Ranbp9 UTSW 13 43425084 missense probably benign 0.33
R9433:Ranbp9 UTSW 13 43422565 missense probably damaging 1.00
X0024:Ranbp9 UTSW 13 43425085 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATGCTTAGCTGTGAATCAGTCCAAG -3'
(R):5'- TCCTTCATCTCCAGGAGTGC -3'

Sequencing Primer
(F):5'- GCTGTGAATCAGTCCAAGTAAAAAC -3'
(R):5'- CATCTCCAGGAGTGCAAATTTG -3'
Posted On 2016-02-04