Incidental Mutation 'R0418:Spag9'
ID 36888
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Name sperm associated antigen 9
Synonyms JLP, Mapk8ip4, 3110018C07Rik, JIP4, 4733401I23Rik, syd1, 4831406C20Rik
MMRRC Submission 038620-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.737) question?
Stock # R0418 (G1)
Quality Score 179
Status Validated
Chromosome 11
Chromosomal Location 93886917-94016911 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 93982579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024979
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041956
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075695
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092777
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103168
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132079
SMART Domains Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 360 394 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153076
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138154
Predicted Effect probably benign
Transcript: ENSMUST00000156019
SMART Domains Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
Pfam:JIP_LZII 240 310 1.1e-32 PFAM
coiled coil region 559 593 N/A INTRINSIC
low complexity region 723 739 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 103,953,675 (GRCm39) probably null Het
Abca14 T C 7: 119,806,657 (GRCm39) L19P probably damaging Het
Abcb1a T A 5: 8,763,281 (GRCm39) V603E probably damaging Het
Acsl5 A G 19: 55,261,238 (GRCm39) D65G probably benign Het
Acss3 T C 10: 106,859,773 (GRCm39) Y311C probably damaging Het
Ak8 T G 2: 28,623,868 (GRCm39) I151S possibly damaging Het
Aldh1a1 T C 19: 20,606,413 (GRCm39) probably benign Het
Aldh1l1 A G 6: 90,546,875 (GRCm39) R393G possibly damaging Het
Ankhd1 T A 18: 36,767,353 (GRCm39) L1164Q probably damaging Het
Ascc3 G T 10: 50,625,022 (GRCm39) V1637L probably benign Het
Atf5 A G 7: 44,462,821 (GRCm39) M101T possibly damaging Het
Det1 T C 7: 78,493,765 (GRCm39) T80A probably benign Het
Dpp9 C T 17: 56,501,404 (GRCm39) probably benign Het
Fam13c A G 10: 70,370,591 (GRCm39) R244G probably damaging Het
Fat3 A T 9: 16,158,192 (GRCm39) N1139K probably damaging Het
Fbxo17 A G 7: 28,432,916 (GRCm39) T146A possibly damaging Het
Fli1 T C 9: 32,363,425 (GRCm39) probably benign Het
Glb1l2 T G 9: 26,705,397 (GRCm39) D151A probably damaging Het
Gli2 G A 1: 118,768,220 (GRCm39) T669I possibly damaging Het
Igsf3 C A 3: 101,342,751 (GRCm39) R463S probably damaging Het
Il1rl2 T C 1: 40,365,662 (GRCm39) V3A unknown Het
Irx3 G A 8: 92,526,708 (GRCm39) S332F probably benign Het
Katnb1 C T 8: 95,822,286 (GRCm39) T303M possibly damaging Het
Lrrc31 A T 3: 30,743,383 (GRCm39) L194Q probably damaging Het
Lrrc37a T G 11: 103,394,264 (GRCm39) E387A probably benign Het
Mapk14 T C 17: 28,910,763 (GRCm39) I17T probably benign Het
Mtif2 A G 11: 29,483,401 (GRCm39) probably benign Het
Myo16 A G 8: 10,619,918 (GRCm39) T1490A probably benign Het
Nfasc A G 1: 132,539,333 (GRCm39) V399A probably damaging Het
Nhsl3 A G 4: 129,117,477 (GRCm39) S396P probably damaging Het
Nobox T C 6: 43,284,169 (GRCm39) K1E probably null Het
Nr2c1 A T 10: 94,017,374 (GRCm39) M371L probably benign Het
Oplah C T 15: 76,182,687 (GRCm39) R924H probably benign Het
Or10ak16 C T 4: 118,750,448 (GRCm39) T56I possibly damaging Het
Or51a10 G A 7: 103,698,979 (GRCm39) T194I probably benign Het
Pappa2 C A 1: 158,544,560 (GRCm39) C1756F probably damaging Het
Pdzd8 G A 19: 59,289,361 (GRCm39) R680C probably damaging Het
Rassf3 G A 10: 121,253,075 (GRCm39) T44M probably benign Het
Rmnd1 T C 10: 4,377,693 (GRCm39) probably null Het
Rnf126 C T 10: 79,598,477 (GRCm39) probably benign Het
Rnf144b T C 13: 47,397,966 (GRCm39) S299P probably benign Het
Ryr2 A G 13: 11,848,981 (GRCm39) probably benign Het
Scel T A 14: 103,840,690 (GRCm39) S511T probably benign Het
Slc16a10 G T 10: 39,916,627 (GRCm39) S138* probably null Het
Slc36a4 A T 9: 15,645,562 (GRCm39) I330F probably damaging Het
Slc5a8 A G 10: 88,722,420 (GRCm39) I84M probably benign Het
Suco C T 1: 161,662,419 (GRCm39) V671I probably benign Het
Suox G A 10: 128,506,754 (GRCm39) P425S probably damaging Het
Tmem266 T A 9: 55,344,697 (GRCm39) V443E probably benign Het
Tmprss11f A T 5: 86,704,870 (GRCm39) I16N probably benign Het
Tnik T A 3: 28,625,029 (GRCm39) Y321* probably null Het
Tnrc6b T C 15: 80,797,524 (GRCm39) M1357T probably benign Het
Tpbg C A 9: 85,726,803 (GRCm39) Y257* probably null Het
Usp37 A T 1: 74,529,266 (GRCm39) S138T probably benign Het
Veph1 T A 3: 66,162,449 (GRCm39) R70* probably null Het
Vmn2r17 C T 5: 109,600,747 (GRCm39) P682S probably damaging Het
Vmn2r79 A C 7: 86,651,611 (GRCm39) N337H probably benign Het
Vstm2b A G 7: 40,551,876 (GRCm39) D68G probably damaging Het
Vwa7 G T 17: 35,236,933 (GRCm39) A167S possibly damaging Het
Zfp647 A T 15: 76,795,586 (GRCm39) I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,713,776 (GRCm39) probably benign Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 93,988,692 (GRCm39) missense probably benign 0.02
IGL01776:Spag9 APN 11 94,007,553 (GRCm39) splice site probably benign
IGL02095:Spag9 APN 11 93,999,408 (GRCm39) missense probably damaging 1.00
IGL02307:Spag9 APN 11 93,992,986 (GRCm39) critical splice donor site probably null
IGL02417:Spag9 APN 11 94,007,567 (GRCm39) missense probably benign 0.27
IGL02480:Spag9 APN 11 93,999,413 (GRCm39) nonsense probably null
IGL02864:Spag9 APN 11 93,997,487 (GRCm39) missense probably damaging 1.00
IGL02976:Spag9 APN 11 93,974,779 (GRCm39) missense probably benign 0.30
IGL02979:Spag9 APN 11 93,988,190 (GRCm39) missense probably benign
IGL03349:Spag9 APN 11 93,984,335 (GRCm39) missense possibly damaging 0.51
dazzle UTSW 11 93,984,450 (GRCm39) nonsense probably null
R0128:Spag9 UTSW 11 93,984,365 (GRCm39) missense probably damaging 1.00
R1463:Spag9 UTSW 11 94,007,663 (GRCm39) missense probably damaging 1.00
R1593:Spag9 UTSW 11 93,988,059 (GRCm39) missense probably damaging 1.00
R1605:Spag9 UTSW 11 93,939,365 (GRCm39) missense probably damaging 0.99
R1649:Spag9 UTSW 11 93,999,278 (GRCm39) splice site probably null
R1697:Spag9 UTSW 11 93,887,391 (GRCm39) missense probably benign 0.00
R1952:Spag9 UTSW 11 93,988,184 (GRCm39) missense possibly damaging 0.77
R2011:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2012:Spag9 UTSW 11 93,983,201 (GRCm39) nonsense probably null
R2351:Spag9 UTSW 11 93,983,726 (GRCm39) missense probably damaging 1.00
R2367:Spag9 UTSW 11 94,007,583 (GRCm39) missense probably damaging 1.00
R3027:Spag9 UTSW 11 93,977,203 (GRCm39) missense probably null 1.00
R3766:Spag9 UTSW 11 93,951,109 (GRCm39) intron probably benign
R3777:Spag9 UTSW 11 93,989,852 (GRCm39) critical splice acceptor site probably null
R3937:Spag9 UTSW 11 93,935,305 (GRCm39) missense possibly damaging 0.92
R3937:Spag9 UTSW 11 93,935,243 (GRCm39) missense possibly damaging 0.94
R4417:Spag9 UTSW 11 93,951,172 (GRCm39) intron probably benign
R4445:Spag9 UTSW 11 93,988,079 (GRCm39) missense possibly damaging 0.95
R4711:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R4799:Spag9 UTSW 11 93,939,343 (GRCm39) missense probably damaging 0.96
R4799:Spag9 UTSW 11 93,939,342 (GRCm39) missense possibly damaging 0.87
R4816:Spag9 UTSW 11 93,939,425 (GRCm39) intron probably benign
R4843:Spag9 UTSW 11 93,988,644 (GRCm39) missense probably damaging 1.00
R5020:Spag9 UTSW 11 93,988,612 (GRCm39) missense probably benign 0.08
R5119:Spag9 UTSW 11 94,013,548 (GRCm39) missense probably damaging 1.00
R5298:Spag9 UTSW 11 93,990,961 (GRCm39) missense probably damaging 1.00
R5304:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5305:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5395:Spag9 UTSW 11 93,982,577 (GRCm39) splice site probably null
R5636:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5638:Spag9 UTSW 11 93,959,838 (GRCm39) missense probably damaging 1.00
R5654:Spag9 UTSW 11 93,981,538 (GRCm39) missense probably damaging 1.00
R5779:Spag9 UTSW 11 94,005,079 (GRCm39) missense probably benign 0.20
R5814:Spag9 UTSW 11 93,973,654 (GRCm39) missense possibly damaging 0.94
R5912:Spag9 UTSW 11 93,935,251 (GRCm39) missense probably damaging 0.98
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6038:Spag9 UTSW 11 94,002,918 (GRCm39) missense probably damaging 1.00
R6269:Spag9 UTSW 11 93,935,333 (GRCm39) missense probably benign 0.05
R6294:Spag9 UTSW 11 93,984,311 (GRCm39) critical splice acceptor site probably null
R6389:Spag9 UTSW 11 93,977,137 (GRCm39) missense probably damaging 1.00
R6420:Spag9 UTSW 11 93,977,128 (GRCm39) missense probably damaging 1.00
R6460:Spag9 UTSW 11 93,959,801 (GRCm39) missense probably damaging 1.00
R6482:Spag9 UTSW 11 93,984,328 (GRCm39) missense possibly damaging 0.94
R6860:Spag9 UTSW 11 93,972,196 (GRCm39) missense probably benign 0.25
R7086:Spag9 UTSW 11 93,988,690 (GRCm39) missense probably benign
R7179:Spag9 UTSW 11 93,980,258 (GRCm39) splice site probably null
R7225:Spag9 UTSW 11 93,988,184 (GRCm39) missense probably damaging 0.98
R7351:Spag9 UTSW 11 93,983,802 (GRCm39) missense probably benign 0.00
R7366:Spag9 UTSW 11 93,999,347 (GRCm39) missense possibly damaging 0.56
R7378:Spag9 UTSW 11 94,005,177 (GRCm39) critical splice donor site probably null
R7401:Spag9 UTSW 11 93,988,515 (GRCm39) missense probably benign
R7506:Spag9 UTSW 11 93,999,290 (GRCm39) missense probably damaging 1.00
R7507:Spag9 UTSW 11 93,958,906 (GRCm39) missense probably benign 0.00
R7513:Spag9 UTSW 11 94,002,909 (GRCm39) missense probably damaging 1.00
R7655:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7656:Spag9 UTSW 11 93,887,389 (GRCm39) missense possibly damaging 0.56
R7664:Spag9 UTSW 11 93,992,986 (GRCm39) critical splice donor site probably null
R7665:Spag9 UTSW 11 93,904,480 (GRCm39) missense probably damaging 0.98
R7862:Spag9 UTSW 11 94,002,892 (GRCm39) missense possibly damaging 0.69
R8074:Spag9 UTSW 11 94,002,877 (GRCm39) missense probably damaging 1.00
R8085:Spag9 UTSW 11 93,989,870 (GRCm39) missense probably benign
R8469:Spag9 UTSW 11 93,982,627 (GRCm39) missense probably damaging 1.00
R8547:Spag9 UTSW 11 94,013,647 (GRCm39) missense possibly damaging 0.84
R8709:Spag9 UTSW 11 93,958,916 (GRCm39) missense probably benign 0.02
R8732:Spag9 UTSW 11 93,962,514 (GRCm39) critical splice donor site probably null
R8899:Spag9 UTSW 11 93,983,695 (GRCm39) missense probably damaging 1.00
R8983:Spag9 UTSW 11 93,958,815 (GRCm39) missense probably benign
R9043:Spag9 UTSW 11 93,951,085 (GRCm39) missense
R9050:Spag9 UTSW 11 93,935,294 (GRCm39) missense probably damaging 0.97
R9502:Spag9 UTSW 11 93,959,792 (GRCm39) missense probably damaging 1.00
R9575:Spag9 UTSW 11 93,962,409 (GRCm39) missense probably damaging 0.99
R9667:Spag9 UTSW 11 93,887,119 (GRCm39) missense possibly damaging 0.83
R9683:Spag9 UTSW 11 93,988,568 (GRCm39) missense probably damaging 1.00
R9774:Spag9 UTSW 11 94,005,062 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGCTGCTTATTCCCTGTTGAAGG -3'
(R):5'- GGCAGTTCCACACTTGTTCCTAAACC -3'

Sequencing Primer
(F):5'- tgtgtACAAGGCTCTAGGGT -3'
(R):5'- GTGCATACCACTACATGTTTGTACAC -3'
Posted On 2013-05-09