Mutagenetix > Incidental Mutation

Incidental Mutation 'R4794:Ubr2'

368884

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

042420-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R4794 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46930445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1728 (W1728R)

Ref Sequence

ENSEMBL: ENSMUSP00000108963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]

AlphaFold

Q6WKZ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000113335
AA Change: W1728R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: W1728R

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113337
AA Change: W1728R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: W1728R

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224442

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224759

Meta Mutation Damage Score

0.9281

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,421,424	I141K	probably damaging	Het
Adgrb1	A	G	15: 74,588,129	E537G	probably damaging	Het
Asic3	C	T	5: 24,415,897	A259V	probably damaging	Het
Bcar1	G	A	8: 111,720,920	Q142*	probably null	Het
Bcas3	T	C	11: 85,509,468	V200A	probably damaging	Het
Cd302	A	T	2: 60,272,149	I42N	probably benign	Het
Colec12	C	A	18: 9,848,984	N387K	probably damaging	Het
Copa	T	A	1: 172,119,321	I1032N	probably damaging	Het
D630003M21Rik	G	C	2: 158,196,139	T1129S	probably benign	Het
D630045J12Rik	G	A	6: 38,194,485	T916I	possibly damaging	Het
Dnajb13	C	T	7: 100,503,992	A241T	probably damaging	Het
Dyrk4	G	T	6: 126,885,337	N397K	possibly damaging	Het
Eftud2	T	A	11: 102,870,177	Y114F	probably benign	Het
Epm2a	A	G	10: 11,390,853	D114G	probably benign	Het
Exoc5	T	C	14: 49,048,900		probably null	Het
Fam135a	G	A	1: 24,029,160	T706I	probably benign	Het
Fasn	A	G	11: 120,811,295	V1845A	probably benign	Het
Fscn3	A	G	6: 28,430,596	E255G	probably damaging	Het
Galnt7	A	T	8: 57,545,363	Y311N	probably damaging	Het
Gm13757	A	T	2: 88,446,347	M197K	probably benign	Het
Gm5724	A	G	6: 141,767,562	V31A	probably benign	Het
Gm8765	C	G	13: 50,703,239	P971R	probably benign	Het
Grid1	T	C	14: 34,822,622	L50P	probably damaging	Het
Hepacam2	A	G	6: 3,475,933	F331L	probably damaging	Het
Ikbkap	ACTTCTTCTTCTTCTTCTTCTTC	ACTTCTTCTTCTTCTTCTTC	4: 56,781,176		probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kif1a	T	C	1: 93,025,727	Y1245C	probably damaging	Het
Ltbp3	T	C	19: 5,756,679	F1022L	probably damaging	Het
Med16	G	T	10: 79,900,117	T399N	probably damaging	Het
Mfsd14a	A	T	3: 116,645,506		probably benign	Het
Myh7b	G	A	2: 155,623,266	V681I	probably benign	Het
Ndc1	A	G	4: 107,390,222	E409G	probably benign	Het
Necap2	A	G	4: 141,071,601		probably benign	Het
Olfr47	T	A	6: 43,235,695	L29H	probably damaging	Het
Olfr847	C	T	9: 19,375,545	S112N	probably benign	Het
Parp12	G	A	6: 39,117,810	T117I	probably benign	Het
Pars2	C	A	4: 106,654,210	C396*	probably null	Het
Prg4	A	T	1: 150,454,546		probably benign	Het
Prkg2	G	A	5: 98,966,633	T523I	probably damaging	Het
Prph	T	A	15: 99,057,427	L425Q	probably damaging	Het
Ranbp9	A	G	13: 43,414,076	Y549H	probably damaging	Het
Rbm12	A	T	2: 156,095,569		probably benign	Het
Reln	T	C	5: 22,344,185	Y75C	probably damaging	Het
Rock2	G	A	12: 16,940,407	R110H	probably damaging	Het
Samd1	G	A	8: 83,999,717	E468K	probably damaging	Het
Samd11	T	A	4: 156,249,465	Q173L	probably damaging	Het
Scgb2b20	C	A	7: 33,365,726	G37V	probably damaging	Het
Sf1	C	A	19: 6,375,664		probably benign	Het
Slc17a5	T	A	9: 78,574,715	H183L	probably damaging	Het
Smgc	T	A	15: 91,841,454	S13T	probably benign	Het
Snapin	A	G	3: 90,490,785		probably benign	Het
Ssc5d	C	T	7: 4,943,745	P1033S	probably benign	Het
Strn3	T	C	12: 51,650,171	E259G	probably benign	Het
Tbc1d32	A	G	10: 56,196,836	F238L	possibly damaging	Het
Tbck	G	A	3: 132,686,968	V57M	possibly damaging	Het
Tgm3	A	G	2: 130,041,955	D511G	probably benign	Het
Tlr5	T	C	1: 182,973,896	V241A	probably benign	Het
Tmem181c-ps	A	G	17: 6,620,355		noncoding transcript	Het
Tnfrsf1a	G	A	6: 125,358,084	C168Y	probably damaging	Het
Tph2	G	T	10: 115,182,770	L79I	possibly damaging	Het
Tsc1	G	A	2: 28,661,690		probably null	Het
Ttc14	A	T	3: 33,803,149	M215L	probably benign	Het
Ube3c	A	G	5: 29,597,085	N120S	probably benign	Het
Vnn1	A	G	10: 23,900,704	T318A	probably benign	Het
Washc2	T	C	6: 116,258,649	V941A	probably benign	Het
Wdfy3	A	G	5: 101,943,943	V510A	probably damaging	Het
Wdsub1	A	T	2: 59,862,844	V272E	possibly damaging	Het
Xylt1	A	C	7: 117,637,635	D537A	probably benign	Het
Zfp57	A	G	17: 37,010,130	N292S	possibly damaging	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	splice site	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2189:Ubr2	UTSW	17	46943364	missense	probably benign	0.01
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5092:Ubr2	UTSW	17	46969247	missense	probably damaging	1.00
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5226:Ubr2	UTSW	17	46983270	missense	probably benign	0.04
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7366:Ubr2	UTSW	17	46955845	missense	probably damaging	0.99
R7449:Ubr2	UTSW	17	46964788	missense	probably damaging	1.00
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7759:Ubr2	UTSW	17	46986048	missense	probably damaging	1.00
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7916:Ubr2	UTSW	17	46968382	critical splice donor site	probably null
R8236:Ubr2	UTSW	17	46951909	missense	probably benign
R8376:Ubr2	UTSW	17	46942795	missense	probably benign	0.07
R9026:Ubr2	UTSW	17	46934115	missense	probably damaging	1.00
R9216:Ubr2	UTSW	17	46981359	missense	probably benign	0.36
R9339:Ubr2	UTSW	17	46973939	missense	probably benign	0.30
R9558:Ubr2	UTSW	17	46951917	missense	probably benign
R9606:Ubr2	UTSW	17	46934094	missense	probably damaging	1.00
R9644:Ubr2	UTSW	17	46955780	critical splice donor site	probably null
R9731:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- CAGCCGAACTTATTTCCTGTTG -3'
(R):5'- TAACTGTGTGGCACTGGAGTAC -3'

Sequencing Primer
(F):5'- CTGTTGTCTTTCTGGAAAAGCC -3'
(R):5'- TGTGGCACTGGAGTACCTACC -3'

Posted On

2016-02-04