Incidental Mutation 'R4794:Ubr2'
ID 368884
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
MMRRC Submission 042420-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock # R4794 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 46928295-47010556 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46930445 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 1728 (W1728R)
Ref Sequence ENSEMBL: ENSMUSP00000108963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]
AlphaFold Q6WKZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000113335
AA Change: W1728R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: W1728R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113337
AA Change: W1728R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: W1728R

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224759
Meta Mutation Damage Score 0.9281 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,421,424 I141K probably damaging Het
Adgrb1 A G 15: 74,588,129 E537G probably damaging Het
Asic3 C T 5: 24,415,897 A259V probably damaging Het
Bcar1 G A 8: 111,720,920 Q142* probably null Het
Bcas3 T C 11: 85,509,468 V200A probably damaging Het
Cd302 A T 2: 60,272,149 I42N probably benign Het
Colec12 C A 18: 9,848,984 N387K probably damaging Het
Copa T A 1: 172,119,321 I1032N probably damaging Het
D630003M21Rik G C 2: 158,196,139 T1129S probably benign Het
D630045J12Rik G A 6: 38,194,485 T916I possibly damaging Het
Dnajb13 C T 7: 100,503,992 A241T probably damaging Het
Dyrk4 G T 6: 126,885,337 N397K possibly damaging Het
Eftud2 T A 11: 102,870,177 Y114F probably benign Het
Epm2a A G 10: 11,390,853 D114G probably benign Het
Exoc5 T C 14: 49,048,900 probably null Het
Fam135a G A 1: 24,029,160 T706I probably benign Het
Fasn A G 11: 120,811,295 V1845A probably benign Het
Fscn3 A G 6: 28,430,596 E255G probably damaging Het
Galnt7 A T 8: 57,545,363 Y311N probably damaging Het
Gm13757 A T 2: 88,446,347 M197K probably benign Het
Gm5724 A G 6: 141,767,562 V31A probably benign Het
Gm8765 C G 13: 50,703,239 P971R probably benign Het
Grid1 T C 14: 34,822,622 L50P probably damaging Het
Hepacam2 A G 6: 3,475,933 F331L probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif1a T C 1: 93,025,727 Y1245C probably damaging Het
Ltbp3 T C 19: 5,756,679 F1022L probably damaging Het
Med16 G T 10: 79,900,117 T399N probably damaging Het
Mfsd14a A T 3: 116,645,506 probably benign Het
Myh7b G A 2: 155,623,266 V681I probably benign Het
Ndc1 A G 4: 107,390,222 E409G probably benign Het
Necap2 A G 4: 141,071,601 probably benign Het
Olfr47 T A 6: 43,235,695 L29H probably damaging Het
Olfr847 C T 9: 19,375,545 S112N probably benign Het
Parp12 G A 6: 39,117,810 T117I probably benign Het
Pars2 C A 4: 106,654,210 C396* probably null Het
Prg4 A T 1: 150,454,546 probably benign Het
Prkg2 G A 5: 98,966,633 T523I probably damaging Het
Prph T A 15: 99,057,427 L425Q probably damaging Het
Ranbp9 A G 13: 43,414,076 Y549H probably damaging Het
Rbm12 A T 2: 156,095,569 probably benign Het
Reln T C 5: 22,344,185 Y75C probably damaging Het
Rock2 G A 12: 16,940,407 R110H probably damaging Het
Samd1 G A 8: 83,999,717 E468K probably damaging Het
Samd11 T A 4: 156,249,465 Q173L probably damaging Het
Scgb2b20 C A 7: 33,365,726 G37V probably damaging Het
Sf1 C A 19: 6,375,664 probably benign Het
Slc17a5 T A 9: 78,574,715 H183L probably damaging Het
Smgc T A 15: 91,841,454 S13T probably benign Het
Snapin A G 3: 90,490,785 probably benign Het
Ssc5d C T 7: 4,943,745 P1033S probably benign Het
Strn3 T C 12: 51,650,171 E259G probably benign Het
Tbc1d32 A G 10: 56,196,836 F238L possibly damaging Het
Tbck G A 3: 132,686,968 V57M possibly damaging Het
Tgm3 A G 2: 130,041,955 D511G probably benign Het
Tlr5 T C 1: 182,973,896 V241A probably benign Het
Tmem181c-ps A G 17: 6,620,355 noncoding transcript Het
Tnfrsf1a G A 6: 125,358,084 C168Y probably damaging Het
Tph2 G T 10: 115,182,770 L79I possibly damaging Het
Tsc1 G A 2: 28,661,690 probably null Het
Ttc14 A T 3: 33,803,149 M215L probably benign Het
Ube3c A G 5: 29,597,085 N120S probably benign Het
Vnn1 A G 10: 23,900,704 T318A probably benign Het
Washc2 T C 6: 116,258,649 V941A probably benign Het
Wdfy3 A G 5: 101,943,943 V510A probably damaging Het
Wdsub1 A T 2: 59,862,844 V272E possibly damaging Het
Xylt1 A C 7: 117,637,635 D537A probably benign Het
Zfp57 A G 17: 37,010,130 N292S possibly damaging Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 splice site probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7916:Ubr2 UTSW 17 46968382 critical splice donor site probably null
R8236:Ubr2 UTSW 17 46951909 missense probably benign
R8376:Ubr2 UTSW 17 46942795 missense probably benign 0.07
R9026:Ubr2 UTSW 17 46934115 missense probably damaging 1.00
R9216:Ubr2 UTSW 17 46981359 missense probably benign 0.36
R9339:Ubr2 UTSW 17 46973939 missense probably benign 0.30
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CAGCCGAACTTATTTCCTGTTG -3'
(R):5'- TAACTGTGTGGCACTGGAGTAC -3'

Sequencing Primer
(F):5'- CTGTTGTCTTTCTGGAAAAGCC -3'
(R):5'- TGTGGCACTGGAGTACCTACC -3'
Posted On 2016-02-04