Incidental Mutation 'R4795:Unc80'
ID368889
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66527941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 902 (I902S)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect probably damaging
Transcript: ENSMUST00000061620
AA Change: I902S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: I902S

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212557
AA Change: I902S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 splice site probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 splice site probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
R7855:Unc80 UTSW 1 66483349 missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66601141 missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66510707 missense probably benign 0.00
R8024:Unc80 UTSW 1 66606644 missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66483304 missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66648913 missense probably benign 0.00
R8135:Unc80 UTSW 1 66509287 missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66651533 missense probably benign 0.33
R8239:Unc80 UTSW 1 66654019 missense probably benign
R8249:Unc80 UTSW 1 66619491 missense probably benign 0.01
R8275:Unc80 UTSW 1 66640614 nonsense probably null
R8288:Unc80 UTSW 1 66473350 missense probably benign 0.07
R8341:Unc80 UTSW 1 66649033 missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66638028 nonsense probably null
R8456:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66473264 missense probably damaging 1.00
R8483:Unc80 UTSW 1 66693710 missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66641629 missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66612268 missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66638032 missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66608490 missense probably benign 0.01
R8755:Unc80 UTSW 1 66612131 missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66646395 missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66590229 missense probably benign 0.05
R8877:Unc80 UTSW 1 66527985 missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66473309 missense possibly damaging 0.94
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66694409 missense probably benign
Z1177:Unc80 UTSW 1 66646398 missense possibly damaging 0.72
Z1177:Unc80 UTSW 1 66695339 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTCTGAGCAGACCTTCAC -3'
(R):5'- TGTAACCTTTCAGCAGCCTG -3'

Sequencing Primer
(F):5'- TTCTGAGCAGACCTTCACAATATC -3'
(R):5'- TTTCAGCAGCCTGGGAGGAG -3'
Posted On2016-02-04