Mutagenetix > Incidental Mutations

Incidental Mutation 'R4795:Cacna1b'

368899

Institutional Source

Beutler Lab

Gene Symbol

Cacna1b

Ensembl Gene

ENSMUSG00000004113

Gene Name

calcium channel, voltage-dependent, N type, alpha 1B subunit

Synonyms

alpha(1B), Cav2.2, Cchn1a

MMRRC Submission

041996-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4795 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24603887-24763152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24637487 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1621 (T1621S)

Ref Sequence

ENSEMBL: ENSMUSP00000037416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041342] [ENSMUST00000070864] [ENSMUST00000100348] [ENSMUST00000102939] [ENSMUST00000114447]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041342
AA Change: T1621S

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000037416
Gene: ENSMUSG00000004113
AA Change: T1621S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.2e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.1e-47	PFAM
Pfam:PKD_channel	569	715	2.3e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1408	2.7e-52	PFAM
Pfam:Ion_trans	1498	1698	1.2e-59	PFAM
Pfam:PKD_channel	1551	1705	8.1e-9	PFAM
Ca_chan_IQ	1837	1871	1.09e-11	SMART
low complexity region	2040	2050	N/A	INTRINSIC
low complexity region	2092	2114	N/A	INTRINSIC
low complexity region	2276	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070864
AA Change: T1618S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000063236
Gene: ENSMUSG00000004113
AA Change: T1618S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	8e-66	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.5e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	848	857	N/A	INTRINSIC
low complexity region	902	912	N/A	INTRINSIC
low complexity region	915	932	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
Pfam:Ion_trans	1173	1403	1.8e-52	PFAM
Pfam:Ion_trans	1493	1695	5.4e-60	PFAM
Pfam:PKD_channel	1544	1702	4.9e-9	PFAM
Ca_chan_IQ	1798	1832	7.2e-12	SMART
low complexity region	2001	2011	N/A	INTRINSIC
low complexity region	2053	2075	N/A	INTRINSIC
low complexity region	2237	2253	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100348
AA Change: T1622S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000097920
Gene: ENSMUSG00000004113
AA Change: T1622S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	468	5e-68	PDB
Pfam:Ion_trans	517	709	1.2e-47	PFAM
Pfam:PKD_channel	570	716	1.6e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1175	1409	3.2e-52	PFAM
Pfam:Ion_trans	1499	1699	1.4e-59	PFAM
Pfam:PKD_channel	1552	1706	5.6e-9	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102939
AA Change: T1619S

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000100003
Gene: ENSMUSG00000004113
AA Change: T1619S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	133	355	1.4e-57	PFAM
PDB:4DEX\|B	358	467	1e-65	PDB
Pfam:Ion_trans	516	708	1.2e-47	PFAM
Pfam:PKD_channel	569	715	1.6e-7	PFAM
low complexity region	728	739	N/A	INTRINSIC
low complexity region	849	858	N/A	INTRINSIC
low complexity region	903	913	N/A	INTRINSIC
low complexity region	916	933	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:Ion_trans	1174	1404	1.9e-52	PFAM
Pfam:Ion_trans	1494	1696	5.5e-60	PFAM
Pfam:PKD_channel	1545	1703	5e-9	PFAM
Ca_chan_IQ	1835	1869	1.09e-11	SMART
low complexity region	2038	2048	N/A	INTRINSIC
low complexity region	2090	2112	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114447
AA Change: T1622S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110090
Gene: ENSMUSG00000004113
AA Change: T1622S

Domain	Start	End	E-Value	Type
low complexity region	9	40	N/A	INTRINSIC
Pfam:Ion_trans	94	367	8.5e-69	PFAM
Pfam:Ion_trans	482	721	2.4e-57	PFAM
Pfam:PKD_channel	571	715	1e-7	PFAM
low complexity region	729	740	N/A	INTRINSIC
low complexity region	850	859	N/A	INTRINSIC
low complexity region	904	914	N/A	INTRINSIC
low complexity region	917	934	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
Pfam:Ion_trans	1139	1421	1.3e-62	PFAM
Pfam:Ion_trans	1464	1711	3.2e-64	PFAM
Pfam:PKD_channel	1550	1706	2.7e-9	PFAM
Pfam:GPHH	1713	1783	1.9e-39	PFAM
Ca_chan_IQ	1838	1872	1.09e-11	SMART
low complexity region	2041	2051	N/A	INTRINSIC
low complexity region	2093	2115	N/A	INTRINSIC
low complexity region	2277	2293	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125798

Meta Mutation Damage Score

0.046

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (123/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the pore-forming subunit of an N-type voltage-dependent calcium channel, which controls neurotransmitter release from neurons. The encoded protein forms a complex with alpha-2, beta, and delta subunits to form the high-voltage activated channel. This channel is sensitive to omega-conotoxin-GVIA and omega-agatoxin-IIIA but insensitive to dihydropyridines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice deficient in this gene exhibit defects in nociception, memory and learning. They also exhibit hyperactive and hyperaggressive behaviors as well as defects in the the sleep-wake cycle. Deficits in the sympathetic nervous system results in defects in circulatory regulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	G	3: 122,176,123	L2259R	probably damaging	Het
Acd	A	G	8: 105,701,015	S2P	possibly damaging	Het
Acsf3	A	G	8: 122,780,157	Y63C	possibly damaging	Het
Adam21	T	C	12: 81,560,974	I5V	probably benign	Het
Adamts6	C	A	13: 104,444,128	S783*	probably null	Het
Adamtsl1	T	C	4: 86,243,769		probably null	Het
Adck2	T	A	6: 39,576,393	S313T	probably benign	Het
Adgb	A	G	10: 10,357,872	I1285T	probably benign	Het
Angptl1	T	A	1: 156,860,583	M485K	possibly damaging	Het
Ank3	G	A	10: 69,858,265	V289I	probably benign	Het
Atp13a4	A	G	16: 29,490,008		probably null	Het
Atp1a1	A	G	3: 101,583,775	L648P	probably benign	Het
Atp2a3	A	G	11: 72,973,029	I194V	probably benign	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Ccdc112	T	A	18: 46,287,672	Q337L	probably benign	Het
Cd34	T	G	1: 194,951,011	S194A	probably damaging	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Commd9	A	G	2: 101,898,896	N116D	probably benign	Het
Dab2	C	A	15: 6,429,611	P335T	probably benign	Het
Epb41l3	T	A	17: 69,248,719		probably null	Het
Epha2	A	G	4: 141,322,416		probably null	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Glyr1	A	C	16: 5,047,758	V44G	probably benign	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm18856	C	A	13: 13,965,208		probably benign	Het
Gm44501	A	G	17: 40,578,714	K40E	probably benign	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Hdhd5	T	C	6: 120,523,446	H97R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hsf5	A	G	11: 87,635,620	M373V	probably benign	Het
Igbp1b	C	T	6: 138,657,805	E214K	probably benign	Het
Iigp1	T	A	18: 60,389,892	F27L	probably benign	Het
Isl1	T	C	13: 116,305,430	N89S	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Kbtbd3	G	A	9: 4,331,073	W482*	probably null	Het
Kcnq1	A	G	7: 143,182,757	T168A	probably benign	Het
Lrch3	A	G	16: 33,005,704	N631S	probably damaging	Het
Lrrk1	T	A	7: 66,262,665	I1716F	possibly damaging	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Map4	T	C	9: 110,035,263	S519P	probably benign	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc5b	A	G	7: 141,849,567	E755G	unknown	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Necab1	G	T	4: 15,111,208	D73E	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nfyb	A	T	10: 82,752,368		probably benign	Het
Nol4	T	C	18: 22,921,887	Q162R	probably damaging	Het
Nwd2	G	A	5: 63,805,433	D787N	probably benign	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr205	C	T	16: 59,328,850	V220I	probably benign	Het
Olfr49	A	G	14: 54,282,547	M116T	probably damaging	Het
Olfr535	A	G	7: 140,493,007	D123G	probably damaging	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr740	A	C	14: 50,453,417	M122L	probably damaging	Het
Olfr908	T	A	9: 38,516,503	M157K	probably damaging	Het
Orai3	T	C	7: 127,773,888	V187A	probably benign	Het
Parn	T	C	16: 13,606,202	T444A	probably benign	Het
Pcdh11x	A	C	X: 120,400,240	N460T	probably damaging	Het
Pcnt	C	T	10: 76,370,024	R2516H	probably benign	Het
Pde4d	T	A	13: 109,938,171		probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pgm1	A	G	5: 64,103,874	Y237C	probably damaging	Het
Plcb2	A	G	2: 118,711,124	V975A	probably benign	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp6r1	C	T	7: 4,641,054	V430M	possibly damaging	Het
Ptges2	C	A	2: 32,396,322	C16*	probably null	Het
Relb	A	T	7: 19,619,839	I38N	probably damaging	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Samsn1	A	G	16: 75,883,845		probably benign	Het
Scrn1	A	G	6: 54,520,769	V279A	possibly damaging	Het
Sec31b	A	G	19: 44,531,746	S200P	probably benign	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Slit3	G	A	11: 35,651,820		probably null	Het
Smo	T	A	6: 29,755,574	V415E	probably damaging	Het
Spag8	C	A	4: 43,652,035	V350L	possibly damaging	Het
Tbck	T	G	3: 132,707,798	L132R	possibly damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tm9sf2	T	A	14: 122,149,840		probably null	Het
Tmem131	A	G	1: 36,841,676	V171A	probably damaging	Het
Tmem209	T	C	6: 30,501,955	T83A	probably benign	Het
Tmem63a	T	C	1: 180,954,851	Y138H	probably damaging	Het
Trim80	A	G	11: 115,447,943	Y533C	probably damaging	Het
Trpv2	A	G	11: 62,581,180	D66G	possibly damaging	Het
Trrap	T	A	5: 144,832,488	I2620N	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Ube2dnl1	G	A	X: 114,905,785	C119Y	possibly damaging	Het
Unc13c	T	A	9: 73,932,187	S461C	probably damaging	Het
Unc80	T	G	1: 66,527,941	I902S	probably damaging	Het
Usp42	C	A	5: 143,723,937	G170W	probably damaging	Het
Vldlr	T	C	19: 27,238,852		probably null	Het
Ywhab	A	G	2: 164,015,345	Y180C	probably damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp318	A	G	17: 46,412,062	T1664A	probably benign	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het
Zfp768	T	C	7: 127,343,375	Q527R	possibly damaging	Het
Zfp975	T	A	7: 42,665,146		probably null	Het

Other mutations in Cacna1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cacna1b	APN	2	24651200	nonsense	probably null
IGL00508:Cacna1b	APN	2	24657289	critical splice donor site	probably null
IGL01085:Cacna1b	APN	2	24678994	missense	probably damaging	0.98
IGL01310:Cacna1b	APN	2	24685782	missense	probably damaging	1.00
IGL01361:Cacna1b	APN	2	24679095	missense	possibly damaging	0.49
IGL01471:Cacna1b	APN	2	24657292	missense	probably damaging	1.00
IGL01537:Cacna1b	APN	2	24658528	missense	probably damaging	1.00
IGL01547:Cacna1b	APN	2	24632035	unclassified	probably benign
IGL01750:Cacna1b	APN	2	24654395	missense	probably damaging	1.00
IGL01813:Cacna1b	APN	2	24609890	missense	probably damaging	1.00
IGL01939:Cacna1b	APN	2	24661757	missense	probably damaging	1.00
IGL01955:Cacna1b	APN	2	24639137	missense	probably damaging	1.00
IGL01972:Cacna1b	APN	2	24635095	critical splice donor site	probably null
IGL01987:Cacna1b	APN	2	24697567	splice site	probably null
IGL02096:Cacna1b	APN	2	24678915	missense	probably benign	0.01
IGL02111:Cacna1b	APN	2	24606991	missense	probably damaging	0.96
IGL02254:Cacna1b	APN	2	24616815	splice site	probably null
IGL03084:Cacna1b	APN	2	24609932	missense	probably benign
IGL03184:Cacna1b	APN	2	24658489	critical splice donor site	probably null
IGL03202:Cacna1b	APN	2	24651112	missense	probably damaging	1.00
IGL03210:Cacna1b	APN	2	24650572	missense	probably benign	0.00
IGL03402:Cacna1b	APN	2	24762809	missense	probably damaging	1.00
PIT4283001:Cacna1b	UTSW	2	24631941	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0062:Cacna1b	UTSW	2	24758331	missense	probably damaging	1.00
R0206:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0208:Cacna1b	UTSW	2	24607480	missense	probably damaging	1.00
R0240:Cacna1b	UTSW	2	24638657	unclassified	probably benign
R0265:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0352:Cacna1b	UTSW	2	24625232	intron	probably benign
R0376:Cacna1b	UTSW	2	24659003	splice site	probably benign
R0383:Cacna1b	UTSW	2	24761844	missense	probably damaging	1.00
R0432:Cacna1b	UTSW	2	24687704	missense	probably damaging	1.00
R0595:Cacna1b	UTSW	2	24649989	splice site	probably benign
R0660:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R0664:Cacna1b	UTSW	2	24654446	missense	probably damaging	1.00
R1107:Cacna1b	UTSW	2	24697603	missense	probably damaging	1.00
R1184:Cacna1b	UTSW	2	24687745	unclassified	probably null
R1445:Cacna1b	UTSW	2	24718136	splice site	probably benign
R1446:Cacna1b	UTSW	2	24706177	missense	probably benign	0.01
R1496:Cacna1b	UTSW	2	24678035	missense	probably benign
R1614:Cacna1b	UTSW	2	24690807	missense	possibly damaging	0.88
R1626:Cacna1b	UTSW	2	24606709	missense	probably damaging	1.00
R1917:Cacna1b	UTSW	2	24616879	missense	probably null	0.80
R1984:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1986:Cacna1b	UTSW	2	24648986	missense	probably damaging	1.00
R1989:Cacna1b	UTSW	2	24721374	missense	probably damaging	1.00
R1990:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1991:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R1992:Cacna1b	UTSW	2	24732306	missense	probably damaging	1.00
R2098:Cacna1b	UTSW	2	24650546	missense	probably damaging	1.00
R2139:Cacna1b	UTSW	2	24679473	missense	probably benign	0.07
R2196:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2229:Cacna1b	UTSW	2	24685804	missense	probably damaging	1.00
R2292:Cacna1b	UTSW	2	24606620	missense	probably benign	0.01
R2570:Cacna1b	UTSW	2	24606637	nonsense	probably null
R2850:Cacna1b	UTSW	2	24761788	missense	probably damaging	1.00
R2911:Cacna1b	UTSW	2	24607541	unclassified	probably null
R2937:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R2938:Cacna1b	UTSW	2	24606528	missense	probably benign	0.00
R3522:Cacna1b	UTSW	2	24763043	missense	possibly damaging	0.94
R3800:Cacna1b	UTSW	2	24658959	missense	probably benign	0.15
R4166:Cacna1b	UTSW	2	24677911	missense	probably benign	0.32
R4300:Cacna1b	UTSW	2	24635239	missense	probably damaging	1.00
R4366:Cacna1b	UTSW	2	24702620	missense	probably damaging	1.00
R4493:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4494:Cacna1b	UTSW	2	24652938	missense	probably damaging	0.99
R4522:Cacna1b	UTSW	2	24654430	missense	probably damaging	1.00
R4612:Cacna1b	UTSW	2	24626852	nonsense	probably null
R4673:Cacna1b	UTSW	2	24631944	missense	probably damaging	1.00
R4703:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4704:Cacna1b	UTSW	2	24654463	missense	probably damaging	1.00
R4777:Cacna1b	UTSW	2	24732325	missense	probably damaging	1.00
R4796:Cacna1b	UTSW	2	24637487	missense	possibly damaging	0.58
R4962:Cacna1b	UTSW	2	24618318	missense	probably damaging	1.00
R4962:Cacna1b	UTSW	2	24657366	missense	probably damaging	1.00
R4974:Cacna1b	UTSW	2	24648523	missense	probably damaging	0.99
R4990:Cacna1b	UTSW	2	24678874	critical splice donor site	probably null
R5109:Cacna1b	UTSW	2	24690785	missense	possibly damaging	0.88
R5117:Cacna1b	UTSW	2	24732328	missense	probably damaging	1.00
R5176:Cacna1b	UTSW	2	24635131	missense	probably damaging	1.00
R5253:Cacna1b	UTSW	2	24719952	missense	probably damaging	1.00
R5372:Cacna1b	UTSW	2	24733959	missense	probably damaging	1.00
R5374:Cacna1b	UTSW	2	24706216	missense	probably damaging	1.00
R5465:Cacna1b	UTSW	2	24650426	critical splice donor site	probably null
R5568:Cacna1b	UTSW	2	24607600	missense	probably damaging	1.00
R5580:Cacna1b	UTSW	2	24650554	missense	probably damaging	1.00
R5677:Cacna1b	UTSW	2	24679358	missense	possibly damaging	0.64
R6277:Cacna1b	UTSW	2	24730796	missense	probably damaging	1.00
R6294:Cacna1b	UTSW	2	24719057	missense	possibly damaging	0.94
R6609:Cacna1b	UTSW	2	24653049	missense	probably damaging	1.00
R6929:Cacna1b	UTSW	2	24632010	missense	probably damaging	1.00
R7016:Cacna1b	UTSW	2	24762848	missense	possibly damaging	0.77
R7112:Cacna1b	UTSW	2	24690761	missense	probably damaging	0.97
R7162:Cacna1b	UTSW	2	24700022	missense	probably benign	0.06
R7401:Cacna1b	UTSW	2	24679294	missense	probably benign	0.00
R7402:Cacna1b	UTSW	2	24607659	missense	probably benign	0.21
R7442:Cacna1b	UTSW	2	24607501	missense	probably benign
R7450:Cacna1b	UTSW	2	24635135	nonsense	probably null
R7481:Cacna1b	UTSW	2	24616862	missense	probably damaging	0.99
Z1088:Cacna1b	UTSW	2	24661844	missense	probably damaging	1.00
Z1088:Cacna1b	UTSW	2	24733945	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACAGGCCTACTTGACAG -3'
(R):5'- TCAGACTTGCATCTGTGGG -3'

Sequencing Primer
(F):5'- CTTGACAGAGACAGCATAGTTTTGG -3'
(R):5'- CATCTGTGGGTAGCCTTAGAGCC -3'

Posted On

2016-02-04