Mutagenetix > Incidental Mutation

Incidental Mutation 'R4795:Atp1a1'

368909

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

041996-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4795 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101583775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 648 (L648P)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

probably benign
Transcript: ENSMUST00000036493
AA Change: L648P

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: L648P

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197360

Meta Mutation Damage Score

0.2371

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (123/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	G	3: 122,176,123	L2259R	probably damaging	Het
Acd	A	G	8: 105,701,015	S2P	possibly damaging	Het
Acsf3	A	G	8: 122,780,157	Y63C	possibly damaging	Het
Adam21	T	C	12: 81,560,974	I5V	probably benign	Het
Adamts6	C	A	13: 104,444,128	S783*	probably null	Het
Adamtsl1	T	C	4: 86,243,769		probably null	Het
Adck2	T	A	6: 39,576,393	S313T	probably benign	Het
Adgb	A	G	10: 10,357,872	I1285T	probably benign	Het
Angptl1	T	A	1: 156,860,583	M485K	possibly damaging	Het
Ank3	G	A	10: 69,858,265	V289I	probably benign	Het
Atp13a4	A	G	16: 29,490,008		probably null	Het
Atp2a3	A	G	11: 72,973,029	I194V	probably benign	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Cacna1b	T	A	2: 24,637,487	T1621S	possibly damaging	Het
Ccdc112	T	A	18: 46,287,672	Q337L	probably benign	Het
Cd34	T	G	1: 194,951,011	S194A	probably damaging	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Commd9	A	G	2: 101,898,896	N116D	probably benign	Het
Dab2	C	A	15: 6,429,611	P335T	probably benign	Het
Epb41l3	T	A	17: 69,248,719		probably null	Het
Epha2	A	G	4: 141,322,416		probably null	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Glyr1	A	C	16: 5,047,758	V44G	probably benign	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm18856	C	A	13: 13,965,208		probably benign	Het
Gm44501	A	G	17: 40,578,714	K40E	probably benign	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Hdhd5	T	C	6: 120,523,446	H97R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hsf5	A	G	11: 87,635,620	M373V	probably benign	Het
Igbp1b	C	T	6: 138,657,805	E214K	probably benign	Het
Iigp1	T	A	18: 60,389,892	F27L	probably benign	Het
Isl1	T	C	13: 116,305,430	N89S	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Kbtbd3	G	A	9: 4,331,073	W482*	probably null	Het
Kcnq1	A	G	7: 143,182,757	T168A	probably benign	Het
Lrch3	A	G	16: 33,005,704	N631S	probably damaging	Het
Lrrk1	T	A	7: 66,262,665	I1716F	possibly damaging	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Map4	T	C	9: 110,035,263	S519P	probably benign	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc5b	A	G	7: 141,849,567	E755G	unknown	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Necab1	G	T	4: 15,111,208	D73E	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nfyb	A	T	10: 82,752,368		probably benign	Het
Nol4	T	C	18: 22,921,887	Q162R	probably damaging	Het
Nwd2	G	A	5: 63,805,433	D787N	probably benign	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr205	C	T	16: 59,328,850	V220I	probably benign	Het
Olfr49	A	G	14: 54,282,547	M116T	probably damaging	Het
Olfr535	A	G	7: 140,493,007	D123G	probably damaging	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr740	A	C	14: 50,453,417	M122L	probably damaging	Het
Olfr908	T	A	9: 38,516,503	M157K	probably damaging	Het
Orai3	T	C	7: 127,773,888	V187A	probably benign	Het
Parn	T	C	16: 13,606,202	T444A	probably benign	Het
Pcdh11x	A	C	X: 120,400,240	N460T	probably damaging	Het
Pcnt	C	T	10: 76,370,024	R2516H	probably benign	Het
Pde4d	T	A	13: 109,938,171		probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pgm1	A	G	5: 64,103,874	Y237C	probably damaging	Het
Plcb2	A	G	2: 118,711,124	V975A	probably benign	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp6r1	C	T	7: 4,641,054	V430M	possibly damaging	Het
Ptges2	C	A	2: 32,396,322	C16*	probably null	Het
Relb	A	T	7: 19,619,839	I38N	probably damaging	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Samsn1	A	G	16: 75,883,845		probably benign	Het
Scrn1	A	G	6: 54,520,769	V279A	possibly damaging	Het
Sec31b	A	G	19: 44,531,746	S200P	probably benign	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Slit3	G	A	11: 35,651,820		probably null	Het
Smo	T	A	6: 29,755,574	V415E	probably damaging	Het
Spag8	C	A	4: 43,652,035	V350L	possibly damaging	Het
Tbck	T	G	3: 132,707,798	L132R	possibly damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tm9sf2	T	A	14: 122,149,840		probably null	Het
Tmem131	A	G	1: 36,841,676	V171A	probably damaging	Het
Tmem209	T	C	6: 30,501,955	T83A	probably benign	Het
Tmem63a	T	C	1: 180,954,851	Y138H	probably damaging	Het
Trim80	A	G	11: 115,447,943	Y533C	probably damaging	Het
Trpv2	A	G	11: 62,581,180	D66G	possibly damaging	Het
Trrap	T	A	5: 144,832,488	I2620N	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Ube2dnl1	G	A	X: 114,905,785	C119Y	possibly damaging	Het
Unc13c	T	A	9: 73,932,187	S461C	probably damaging	Het
Unc80	T	G	1: 66,527,941	I902S	probably damaging	Het
Usp42	C	A	5: 143,723,937	G170W	probably damaging	Het
Vldlr	T	C	19: 27,238,852		probably null	Het
Ywhab	A	G	2: 164,015,345	Y180C	probably damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp318	A	G	17: 46,412,062	T1664A	probably benign	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het
Zfp768	T	C	7: 127,343,375	Q527R	possibly damaging	Het
Zfp975	T	A	7: 42,665,146		probably null	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
R9712:Atp1a1	UTSW	3	101591441	missense	probably benign	0.06
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCTCAGCAAGTGGGATTCC -3'
(R):5'- GGTCATGTGTCATAAAATCTTGGTG -3'

Sequencing Primer
(F):5'- TCCCAGCCTCTTACACCATTACATC -3'
(R):5'- GTTGGGATGTGTTTCCGTAAAACC -3'

Posted On

2016-02-04