Incidental Mutation 'R4795:Spag8'
ID368916
Institutional Source Beutler Lab
Gene Symbol Spag8
Ensembl Gene ENSMUSG00000066196
Gene Namesperm associated antigen 8
Synonyms
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43651335-43653594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43652035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 350 (V350L)
Ref Sequence ENSEMBL: ENSMUSP00000103502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000030192] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030192
SMART Domains Protein: ENSMUSP00000030192
Gene: ENSMUSG00000028470

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DcpS_C 53 159 7.1e-25 PFAM
Pfam:HIT 61 158 1.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084646
AA Change: V350L

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196
AA Change: V350L

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107870
AA Change: V350L

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196
AA Change: V350L

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Predicted Effect unknown
Transcript: ENSMUST00000149575
AA Change: V17L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155985
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Spag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Spag8 APN 4 43652890 nonsense probably null
IGL01766:Spag8 APN 4 43653209 unclassified probably benign
IGL02043:Spag8 APN 4 43653134 unclassified probably benign
IGL02324:Spag8 APN 4 43651781 missense probably damaging 1.00
IGL02812:Spag8 APN 4 43651755 missense probably damaging 0.96
IGL03336:Spag8 APN 4 43652114 splice site probably benign
R1519:Spag8 UTSW 4 43652777 missense possibly damaging 0.88
R1799:Spag8 UTSW 4 43653087 unclassified probably benign
R1799:Spag8 UTSW 4 43653345 unclassified probably benign
R2212:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R2338:Spag8 UTSW 4 43652826 missense probably benign 0.06
R3412:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R3413:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R3414:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R4666:Spag8 UTSW 4 43653408 unclassified probably benign
R4670:Spag8 UTSW 4 43653378 unclassified probably benign
R4745:Spag8 UTSW 4 43651636 missense probably damaging 0.98
R5409:Spag8 UTSW 4 43653134 unclassified probably benign
R5992:Spag8 UTSW 4 43651534 missense probably benign 0.06
R6192:Spag8 UTSW 4 43652458 missense probably damaging 1.00
R6333:Spag8 UTSW 4 43653186 unclassified probably benign
R7216:Spag8 UTSW 4 43652034 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAACTTCCAGGATTGCTGCTC -3'
(R):5'- GGTGGCTATAAGGGCAAACC -3'

Sequencing Primer
(F):5'- TCTCCCACTCCTAGGCAGAG -3'
(R):5'- GCTCAACTCATTTCTGACGCTAG -3'
Posted On2016-02-04