Incidental Mutation 'R0418:Scel'
ID 36892
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
MMRRC Submission 038620-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0418 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 103750778-103850233 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103840690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 511 (S511T)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: S531T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: S531T

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: S511T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 103,953,675 (GRCm39) probably null Het
Abca14 T C 7: 119,806,657 (GRCm39) L19P probably damaging Het
Abcb1a T A 5: 8,763,281 (GRCm39) V603E probably damaging Het
Acsl5 A G 19: 55,261,238 (GRCm39) D65G probably benign Het
Acss3 T C 10: 106,859,773 (GRCm39) Y311C probably damaging Het
Ak8 T G 2: 28,623,868 (GRCm39) I151S possibly damaging Het
Aldh1a1 T C 19: 20,606,413 (GRCm39) probably benign Het
Aldh1l1 A G 6: 90,546,875 (GRCm39) R393G possibly damaging Het
Ankhd1 T A 18: 36,767,353 (GRCm39) L1164Q probably damaging Het
Ascc3 G T 10: 50,625,022 (GRCm39) V1637L probably benign Het
Atf5 A G 7: 44,462,821 (GRCm39) M101T possibly damaging Het
Det1 T C 7: 78,493,765 (GRCm39) T80A probably benign Het
Dpp9 C T 17: 56,501,404 (GRCm39) probably benign Het
Fam13c A G 10: 70,370,591 (GRCm39) R244G probably damaging Het
Fat3 A T 9: 16,158,192 (GRCm39) N1139K probably damaging Het
Fbxo17 A G 7: 28,432,916 (GRCm39) T146A possibly damaging Het
Fli1 T C 9: 32,363,425 (GRCm39) probably benign Het
Glb1l2 T G 9: 26,705,397 (GRCm39) D151A probably damaging Het
Gli2 G A 1: 118,768,220 (GRCm39) T669I possibly damaging Het
Igsf3 C A 3: 101,342,751 (GRCm39) R463S probably damaging Het
Il1rl2 T C 1: 40,365,662 (GRCm39) V3A unknown Het
Irx3 G A 8: 92,526,708 (GRCm39) S332F probably benign Het
Katnb1 C T 8: 95,822,286 (GRCm39) T303M possibly damaging Het
Lrrc31 A T 3: 30,743,383 (GRCm39) L194Q probably damaging Het
Lrrc37a T G 11: 103,394,264 (GRCm39) E387A probably benign Het
Mapk14 T C 17: 28,910,763 (GRCm39) I17T probably benign Het
Mtif2 A G 11: 29,483,401 (GRCm39) probably benign Het
Myo16 A G 8: 10,619,918 (GRCm39) T1490A probably benign Het
Nfasc A G 1: 132,539,333 (GRCm39) V399A probably damaging Het
Nhsl3 A G 4: 129,117,477 (GRCm39) S396P probably damaging Het
Nobox T C 6: 43,284,169 (GRCm39) K1E probably null Het
Nr2c1 A T 10: 94,017,374 (GRCm39) M371L probably benign Het
Oplah C T 15: 76,182,687 (GRCm39) R924H probably benign Het
Or10ak16 C T 4: 118,750,448 (GRCm39) T56I possibly damaging Het
Or51a10 G A 7: 103,698,979 (GRCm39) T194I probably benign Het
Pappa2 C A 1: 158,544,560 (GRCm39) C1756F probably damaging Het
Pdzd8 G A 19: 59,289,361 (GRCm39) R680C probably damaging Het
Rassf3 G A 10: 121,253,075 (GRCm39) T44M probably benign Het
Rmnd1 T C 10: 4,377,693 (GRCm39) probably null Het
Rnf126 C T 10: 79,598,477 (GRCm39) probably benign Het
Rnf144b T C 13: 47,397,966 (GRCm39) S299P probably benign Het
Ryr2 A G 13: 11,848,981 (GRCm39) probably benign Het
Slc16a10 G T 10: 39,916,627 (GRCm39) S138* probably null Het
Slc36a4 A T 9: 15,645,562 (GRCm39) I330F probably damaging Het
Slc5a8 A G 10: 88,722,420 (GRCm39) I84M probably benign Het
Spag9 T C 11: 93,982,579 (GRCm39) probably benign Het
Suco C T 1: 161,662,419 (GRCm39) V671I probably benign Het
Suox G A 10: 128,506,754 (GRCm39) P425S probably damaging Het
Tmem266 T A 9: 55,344,697 (GRCm39) V443E probably benign Het
Tmprss11f A T 5: 86,704,870 (GRCm39) I16N probably benign Het
Tnik T A 3: 28,625,029 (GRCm39) Y321* probably null Het
Tnrc6b T C 15: 80,797,524 (GRCm39) M1357T probably benign Het
Tpbg C A 9: 85,726,803 (GRCm39) Y257* probably null Het
Usp37 A T 1: 74,529,266 (GRCm39) S138T probably benign Het
Veph1 T A 3: 66,162,449 (GRCm39) R70* probably null Het
Vmn2r17 C T 5: 109,600,747 (GRCm39) P682S probably damaging Het
Vmn2r79 A C 7: 86,651,611 (GRCm39) N337H probably benign Het
Vstm2b A G 7: 40,551,876 (GRCm39) D68G probably damaging Het
Vwa7 G T 17: 35,236,933 (GRCm39) A167S possibly damaging Het
Zfp647 A T 15: 76,795,586 (GRCm39) I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,713,776 (GRCm39) probably benign Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103,767,431 (GRCm39) missense probably benign 0.01
IGL00913:Scel APN 14 103,819,245 (GRCm39) missense probably benign 0.35
IGL01086:Scel APN 14 103,849,827 (GRCm39) missense probably benign 0.05
IGL01352:Scel APN 14 103,770,774 (GRCm39) missense possibly damaging 0.54
IGL01396:Scel APN 14 103,845,530 (GRCm39) splice site probably benign
IGL01954:Scel APN 14 103,840,678 (GRCm39) splice site probably benign
IGL02064:Scel APN 14 103,770,762 (GRCm39) missense probably damaging 0.98
IGL02186:Scel APN 14 103,802,257 (GRCm39) missense probably benign 0.23
IGL02475:Scel APN 14 103,774,444 (GRCm39) missense possibly damaging 0.95
IGL02926:Scel APN 14 103,813,683 (GRCm39) nonsense probably null
IGL03122:Scel APN 14 103,836,842 (GRCm39) missense possibly damaging 0.66
IGL03135:Scel APN 14 103,823,950 (GRCm39) missense probably benign 0.02
PIT4585001:Scel UTSW 14 103,829,804 (GRCm39) missense possibly damaging 0.90
R0346:Scel UTSW 14 103,767,420 (GRCm39) missense probably damaging 1.00
R0394:Scel UTSW 14 103,799,954 (GRCm39) missense probably benign 0.15
R0635:Scel UTSW 14 103,820,575 (GRCm39) critical splice donor site probably null
R0815:Scel UTSW 14 103,823,916 (GRCm39) missense possibly damaging 0.83
R0863:Scel UTSW 14 103,823,916 (GRCm39) missense possibly damaging 0.83
R0990:Scel UTSW 14 103,819,268 (GRCm39) missense possibly damaging 0.55
R1084:Scel UTSW 14 103,802,279 (GRCm39) critical splice donor site probably null
R1641:Scel UTSW 14 103,770,752 (GRCm39) missense probably damaging 1.00
R2001:Scel UTSW 14 103,848,226 (GRCm39) missense possibly damaging 0.66
R2002:Scel UTSW 14 103,779,421 (GRCm39) missense probably damaging 1.00
R2341:Scel UTSW 14 103,845,606 (GRCm39) missense possibly damaging 0.92
R3425:Scel UTSW 14 103,845,542 (GRCm39) missense possibly damaging 0.92
R3836:Scel UTSW 14 103,829,822 (GRCm39) missense possibly damaging 0.66
R4035:Scel UTSW 14 103,767,440 (GRCm39) missense probably damaging 1.00
R4197:Scel UTSW 14 103,836,836 (GRCm39) missense probably damaging 0.97
R4737:Scel UTSW 14 103,809,473 (GRCm39) missense possibly damaging 0.79
R4801:Scel UTSW 14 103,820,536 (GRCm39) missense probably benign 0.01
R4802:Scel UTSW 14 103,820,536 (GRCm39) missense probably benign 0.01
R5369:Scel UTSW 14 103,823,929 (GRCm39) missense probably benign 0.00
R5555:Scel UTSW 14 103,839,642 (GRCm39) missense probably benign 0.27
R5582:Scel UTSW 14 103,820,575 (GRCm39) critical splice donor site probably benign
R5931:Scel UTSW 14 103,843,060 (GRCm39) nonsense probably null
R5978:Scel UTSW 14 103,766,690 (GRCm39) splice site probably null
R6045:Scel UTSW 14 103,829,649 (GRCm39) missense probably benign 0.12
R6062:Scel UTSW 14 103,822,572 (GRCm39) missense possibly damaging 0.82
R6218:Scel UTSW 14 103,809,478 (GRCm39) missense probably benign 0.12
R6225:Scel UTSW 14 103,829,420 (GRCm39) missense probably benign 0.27
R7102:Scel UTSW 14 103,781,268 (GRCm39) nonsense probably null
R7349:Scel UTSW 14 103,781,315 (GRCm39) missense probably benign 0.11
R8376:Scel UTSW 14 103,809,451 (GRCm39) missense probably benign 0.02
R8924:Scel UTSW 14 103,829,807 (GRCm39) missense possibly damaging 0.66
R9014:Scel UTSW 14 103,822,575 (GRCm39) missense probably benign
R9130:Scel UTSW 14 103,770,746 (GRCm39) missense probably benign 0.05
R9135:Scel UTSW 14 103,839,626 (GRCm39) missense probably benign
R9179:Scel UTSW 14 103,811,836 (GRCm39) missense possibly damaging 0.79
R9614:Scel UTSW 14 103,843,032 (GRCm39) missense probably damaging 1.00
R9638:Scel UTSW 14 103,779,409 (GRCm39) missense possibly damaging 0.89
R9672:Scel UTSW 14 103,836,838 (GRCm39) missense possibly damaging 0.82
R9719:Scel UTSW 14 103,809,442 (GRCm39) critical splice acceptor site probably null
X0026:Scel UTSW 14 103,829,429 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCAGACACTAATGTGCAGTACACGG -3'
(R):5'- ACTCCCTGAAATGGTAGCACCTCG -3'

Sequencing Primer
(F):5'- TGTGCAGTACACGGATCATTC -3'
(R):5'- TCGGGTGTGGCACTGAC -3'
Posted On 2013-05-09