Incidental Mutation 'R0418:Scel'
ID36892
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103603254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 511 (S511T)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: S531T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: S531T

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: S511T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCAGACACTAATGTGCAGTACACGG -3'
(R):5'- ACTCCCTGAAATGGTAGCACCTCG -3'

Sequencing Primer
(F):5'- TGTGCAGTACACGGATCATTC -3'
(R):5'- TCGGGTGTGGCACTGAC -3'
Posted On2013-05-09