Mutagenetix > Incidental Mutation

Incidental Mutation 'R0418:Scel'

36892

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

038620-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103603254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 511 (S511T)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably benign
Transcript: ENSMUST00000095576
AA Change: S531T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: S531T

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322
AA Change: S511T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.2%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930018P22Rik	G	T	2: 104,123,330		probably null	Het
Abca14	T	C	7: 120,207,434	L19P	probably damaging	Het
Abcb1a	T	A	5: 8,713,281	V603E	probably damaging	Het
Acsl5	A	G	19: 55,272,806	D65G	probably benign	Het
Acss3	T	C	10: 107,023,912	Y311C	probably damaging	Het
Ak8	T	G	2: 28,733,856	I151S	possibly damaging	Het
Aldh1a1	T	C	19: 20,629,049		probably benign	Het
Aldh1l1	A	G	6: 90,569,893	R393G	possibly damaging	Het
Ankhd1	T	A	18: 36,634,300	L1164Q	probably damaging	Het
Ascc3	G	T	10: 50,748,926	V1637L	probably benign	Het
Atf5	A	G	7: 44,813,397	M101T	possibly damaging	Het
C77080	A	G	4: 129,223,684	S396P	probably damaging	Het
Det1	T	C	7: 78,844,017	T80A	probably benign	Het
Dpp9	C	T	17: 56,194,404		probably benign	Het
Fam13c	A	G	10: 70,534,761	R244G	probably damaging	Het
Fat3	A	T	9: 16,246,896	N1139K	probably damaging	Het
Fbxo17	A	G	7: 28,733,491	T146A	possibly damaging	Het
Fli1	T	C	9: 32,452,129		probably benign	Het
Glb1l2	T	G	9: 26,794,101	D151A	probably damaging	Het
Gli2	G	A	1: 118,840,490	T669I	possibly damaging	Het
Igsf3	C	A	3: 101,435,435	R463S	probably damaging	Het
Il1rl2	T	C	1: 40,326,502	V3A	unknown	Het
Irx3	G	A	8: 91,800,080	S332F	probably benign	Het
Katnb1	C	T	8: 95,095,658	T303M	possibly damaging	Het
Lrrc31	A	T	3: 30,689,234	L194Q	probably damaging	Het
Lrrc37a	T	G	11: 103,503,438	E387A	probably benign	Het
Mapk14	T	C	17: 28,691,789	I17T	probably benign	Het
Mtif2	A	G	11: 29,533,401		probably benign	Het
Myo16	A	G	8: 10,569,918	T1490A	probably benign	Het
Nfasc	A	G	1: 132,611,595	V399A	probably damaging	Het
Nobox	T	C	6: 43,307,235	K1E	probably null	Het
Nr2c1	A	T	10: 94,181,512	M371L	probably benign	Het
Olfr1330	C	T	4: 118,893,251	T56I	possibly damaging	Het
Olfr642	G	A	7: 104,049,772	T194I	probably benign	Het
Oplah	C	T	15: 76,298,487	R924H	probably benign	Het
Pappa2	C	A	1: 158,716,990	C1756F	probably damaging	Het
Pdzd8	G	A	19: 59,300,929	R680C	probably damaging	Het
Rassf3	G	A	10: 121,417,170	T44M	probably benign	Het
Rmnd1	T	C	10: 4,427,693		probably null	Het
Rnf126	C	T	10: 79,762,643		probably benign	Het
Rnf144b	T	C	13: 47,244,490	S299P	probably benign	Het
Ryr2	A	G	13: 11,834,095		probably benign	Het
Slc16a10	G	T	10: 40,040,631	S138*	probably null	Het
Slc36a4	A	T	9: 15,734,266	I330F	probably damaging	Het
Slc5a8	A	G	10: 88,886,558	I84M	probably benign	Het
Spag9	T	C	11: 94,091,753		probably benign	Het
Suco	C	T	1: 161,834,850	V671I	probably benign	Het
Suox	G	A	10: 128,670,885	P425S	probably damaging	Het
Tmem266	T	A	9: 55,437,413	V443E	probably benign	Het
Tmprss11f	A	T	5: 86,557,011	I16N	probably benign	Het
Tnik	T	A	3: 28,570,880	Y321*	probably null	Het
Tnrc6b	T	C	15: 80,913,323	M1357T	probably benign	Het
Tpbg	C	A	9: 85,844,750	Y257*	probably null	Het
Usp37	A	T	1: 74,490,107	S138T	probably benign	Het
Veph1	T	A	3: 66,255,028	R70*	probably null	Het
Vmn2r17	C	T	5: 109,452,881	P682S	probably damaging	Het
Vmn2r79	A	C	7: 87,002,403	N337H	probably benign	Het
Vstm2b	A	G	7: 40,902,452	D68G	probably damaging	Het
Vwa7	G	T	17: 35,017,957	A167S	possibly damaging	Het
Zfp647	A	T	15: 76,911,386	I358N	probably damaging	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CCAGACACTAATGTGCAGTACACGG -3'
(R):5'- ACTCCCTGAAATGGTAGCACCTCG -3'

Sequencing Primer
(F):5'- TGTGCAGTACACGGATCATTC -3'
(R):5'- TCGGGTGTGGCACTGAC -3'

Posted On

2013-05-09