Incidental Mutation 'R4795:Pgm1'
ID368922
Institutional Source Beutler Lab
Gene Symbol Pgm1
Ensembl Gene ENSMUSG00000029171
Gene Namephosphoglucomutase 1
SynonymsPgm-1, 3230402E02Rik
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64092950-64128351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64103874 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 237 (Y237C)
Ref Sequence ENSEMBL: ENSMUSP00000084582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087324]
Predicted Effect probably damaging
Transcript: ENSMUST00000087324
AA Change: Y237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084582
Gene: ENSMUSG00000029171
AA Change: Y237C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:PGM_PMM_I 62 211 7.8e-37 PFAM
Pfam:PGM_PMM_II 235 344 1.9e-25 PFAM
Pfam:PGM_PMM_III 351 480 4.6e-15 PFAM
Pfam:PGM_PMM_IV 523 603 5.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177427
Predicted Effect probably benign
Transcript: ENSMUST00000199093
Meta Mutation Damage Score 0.9747 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype PHENOTYPE: Four electrophoretic variants are known, each with a 5-band pattern: the a allele in C57BL/6, BALB/c and AKR; b allele in DBA/2 and SJL; c allele in C3H/He; and d allele in 129/Re. Heterozygotes show a mixture of bands. Mice homozygous for a spontaneous null allele or ENU induced alleles are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Pgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Pgm1 APN 5 64108269 splice site probably benign
IGL01068:Pgm1 APN 5 64107796 missense probably damaging 0.99
IGL01112:Pgm1 APN 5 64102882 missense possibly damaging 0.86
IGL01634:Pgm1 APN 5 64100974 missense probably benign 0.01
IGL02513:Pgm1 APN 5 64102946 unclassified probably benign
R0255:Pgm1 UTSW 5 64112043 missense possibly damaging 0.93
R0268:Pgm1 UTSW 5 64105808 missense probably damaging 1.00
R0511:Pgm1 UTSW 5 64110555 missense probably damaging 1.00
R0722:Pgm1 UTSW 5 64107679 nonsense probably null
R0881:Pgm1 UTSW 5 64093008 missense unknown
R0924:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R0930:Pgm1 UTSW 5 64112147 missense possibly damaging 0.90
R1773:Pgm1 UTSW 5 64107851 critical splice donor site probably null
R1777:Pgm1 UTSW 5 64127782 missense probably benign
R2137:Pgm1 UTSW 5 64116366 missense probably benign
R2244:Pgm1 UTSW 5 64106702 missense probably benign 0.00
R3946:Pgm1 UTSW 5 64112061 missense probably benign
R4301:Pgm1 UTSW 5 64103797 nonsense probably null
R4601:Pgm1 UTSW 5 64107727 missense probably benign 0.02
R4631:Pgm1 UTSW 5 64105947 splice site probably null
R4871:Pgm1 UTSW 5 64103894 missense probably benign
R4893:Pgm1 UTSW 5 64105940 missense probably benign
R4907:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R4915:Pgm1 UTSW 5 64100948 missense probably damaging 1.00
R5092:Pgm1 UTSW 5 64107749 missense possibly damaging 0.49
R5197:Pgm1 UTSW 5 64105832 missense possibly damaging 0.87
R5621:Pgm1 UTSW 5 64112038 nonsense probably null
R6311:Pgm1 UTSW 5 64116415 missense probably benign 0.05
R6651:Pgm1 UTSW 5 64112094 missense probably benign 0.07
R6731:Pgm1 UTSW 5 64100975 missense probably benign 0.27
R6885:Pgm1 UTSW 5 64103878 missense probably benign 0.00
R6919:Pgm1 UTSW 5 64097025 missense probably benign 0.11
R7211:Pgm1 UTSW 5 64105850 missense probably damaging 0.99
R7631:Pgm1 UTSW 5 64108179 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCATTCCTGGCTTCTCTAGG -3'
(R):5'- GCTCTGTGTAGCCAGCAATG -3'

Sequencing Primer
(F):5'- TCTCTAGGTCTACTGGGACAACG -3'
(R):5'- TCTTTAAGAAAAGGTGGCCAGCTC -3'
Posted On2016-02-04