Incidental Mutation 'R0418:Tnrc6b'
ID36895
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80913323 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1357 (M1357T)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect probably benign
Transcript: ENSMUST00000067689
AA Change: M1357T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: M1357T

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect unknown
Transcript: ENSMUST00000228124
AA Change: M504T
Meta Mutation Damage Score 0.1145 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R7914:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGACCTTGTACTGGCTCCTAAACCC -3'
(R):5'- AAGATTCTGCTACTAACATGAGGCTGC -3'

Sequencing Primer
(F):5'- GTCAGAGAATGGTTGAATCCCCC -3'
(R):5'- AACATGAGGCTGCTCTCTCAC -3'
Posted On2013-05-09