Mutagenetix > Incidental Mutations

Incidental Mutation 'R4795:Isl1'

368971

Institutional Source

Beutler Lab

Gene Symbol

Isl1

Ensembl Gene

ENSMUSG00000042258

Gene Name

ISL1 transcription factor, LIM/homeodomain

Synonyms

Islet 1

MMRRC Submission

041996-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4795 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

116298281-116309689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116305430 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 89 (N89S)

Ref Sequence

ENSEMBL: ENSMUSP00000135567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036060] [ENSMUST00000176044]

Predicted Effect

probably benign
Transcript: ENSMUST00000036060
AA Change: N89S

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000044879
Gene: ENSMUSG00000042258
AA Change: N89S

Domain	Start	End	E-Value	Type
LIM	16	70	1.39e-13	SMART
LIM	78	132	4.99e-15	SMART
HOX	181	243	1.83e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176044
AA Change: N89S

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000135567
Gene: ENSMUSG00000042258
AA Change: N89S

Domain	Start	End	E-Value	Type
LIM	16	70	1.39e-13	SMART
LIM	78	132	4.99e-15	SMART
HOX	181	243	1.83e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176812

SMART Domains

Protein: ENSMUSP00000135793
Gene: ENSMUSG00000042258

Domain	Start	End	E-Value	Type
LIM	1	40	1.3e-5	SMART
HOX	89	151	9.4e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177469

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195602

Meta Mutation Damage Score

0.0711

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (123/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to develop motor neurons and die by embryonic day 11.5 with abnormal heart and pancreas development. Mice heterozygous for an ENU mutation exhibit chronic otitis media and hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	G	3: 122,176,123	L2259R	probably damaging	Het
Acd	A	G	8: 105,701,015	S2P	possibly damaging	Het
Acsf3	A	G	8: 122,780,157	Y63C	possibly damaging	Het
Adam21	T	C	12: 81,560,974	I5V	probably benign	Het
Adamts6	C	A	13: 104,444,128	S783*	probably null	Het
Adamtsl1	T	C	4: 86,243,769		probably null	Het
Adck2	T	A	6: 39,576,393	S313T	probably benign	Het
Adgb	A	G	10: 10,357,872	I1285T	probably benign	Het
Angptl1	T	A	1: 156,860,583	M485K	possibly damaging	Het
Ank3	G	A	10: 69,858,265	V289I	probably benign	Het
Atp13a4	A	G	16: 29,490,008		probably null	Het
Atp1a1	A	G	3: 101,583,775	L648P	probably benign	Het
Atp2a3	A	G	11: 72,973,029	I194V	probably benign	Het
Bglap	A	C	3: 88,384,405	I4S	unknown	Het
Cacna1b	T	A	2: 24,637,487	T1621S	possibly damaging	Het
Ccdc112	T	A	18: 46,287,672	Q337L	probably benign	Het
Cd34	T	G	1: 194,951,011	S194A	probably damaging	Het
Cdh20	A	G	1: 104,941,264	D160G	probably damaging	Het
Clock	T	C	5: 76,265,916	K44R	probably damaging	Het
Commd9	A	G	2: 101,898,896	N116D	probably benign	Het
Dab2	C	A	15: 6,429,611	P335T	probably benign	Het
Epb41l3	T	A	17: 69,248,719		probably null	Het
Epha2	A	G	4: 141,322,416		probably null	Het
Fam78b	T	C	1: 167,078,647	V125A	probably benign	Het
Fars2	A	T	13: 36,537,426	E448V	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Glyr1	A	C	16: 5,047,758	V44G	probably benign	Het
Gm1527	A	G	3: 28,920,663	I542V	possibly damaging	Het
Gm18856	C	A	13: 13,965,208		probably benign	Het
Gm44501	A	G	17: 40,578,714	K40E	probably benign	Het
Gm6583	A	G	5: 112,355,299	S180P	possibly damaging	Het
Hdhd5	T	C	6: 120,523,446	H97R	probably benign	Het
Hmcn1	A	G	1: 150,753,611	V965A	probably benign	Het
Hsf5	A	G	11: 87,635,620	M373V	probably benign	Het
Igbp1b	C	T	6: 138,657,805	E214K	probably benign	Het
Iigp1	T	A	18: 60,389,892	F27L	probably benign	Het
Itga1	C	A	13: 115,035,385	W61C	probably damaging	Het
Itga5	T	C	15: 103,347,760	R922G	probably benign	Het
Kbtbd3	G	A	9: 4,331,073	W482*	probably null	Het
Kcnq1	A	G	7: 143,182,757	T168A	probably benign	Het
Lrch3	A	G	16: 33,005,704	N631S	probably damaging	Het
Lrrk1	T	A	7: 66,262,665	I1716F	possibly damaging	Het
Ly75	T	C	2: 60,349,940	E631G	probably benign	Het
Map4	T	C	9: 110,035,263	S519P	probably benign	Het
Mkl1	C	T	15: 81,017,033	S419N	probably damaging	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Muc5b	A	G	7: 141,849,567	E755G	unknown	Het
Ncaph2	T	G	15: 89,370,807	V478G	probably damaging	Het
Ncbp1	A	G	4: 46,152,967	R247G	possibly damaging	Het
Necab1	G	T	4: 15,111,208	D73E	possibly damaging	Het
Nedd9	T	C	13: 41,317,900	K208E	probably benign	Het
Nfyb	A	T	10: 82,752,368		probably benign	Het
Nol4	T	C	18: 22,921,887	Q162R	probably damaging	Het
Nwd2	G	A	5: 63,805,433	D787N	probably benign	Het
Olfr2	C	T	7: 107,001,335	G175D	probably damaging	Het
Olfr205	C	T	16: 59,328,850	V220I	probably benign	Het
Olfr49	A	G	14: 54,282,547	M116T	probably damaging	Het
Olfr535	A	G	7: 140,493,007	D123G	probably damaging	Het
Olfr713	A	T	7: 107,036,914	Y253F	probably benign	Het
Olfr740	A	C	14: 50,453,417	M122L	probably damaging	Het
Olfr908	T	A	9: 38,516,503	M157K	probably damaging	Het
Orai3	T	C	7: 127,773,888	V187A	probably benign	Het
Parn	T	C	16: 13,606,202	T444A	probably benign	Het
Pcdh11x	A	C	X: 120,400,240	N460T	probably damaging	Het
Pcnt	C	T	10: 76,370,024	R2516H	probably benign	Het
Pde4d	T	A	13: 109,938,171		probably benign	Het
Pdgfra	A	G	5: 75,189,311	N952S	probably benign	Het
Pgm1	A	G	5: 64,103,874	Y237C	probably damaging	Het
Plcb2	A	G	2: 118,711,124	V975A	probably benign	Het
Polk	T	C	13: 96,489,256	T347A	probably benign	Het
Ppp6r1	C	T	7: 4,641,054	V430M	possibly damaging	Het
Ptges2	C	A	2: 32,396,322	C16*	probably null	Het
Relb	A	T	7: 19,619,839	I38N	probably damaging	Het
Runx1t1	T	A	4: 13,837,767	N51K	probably damaging	Het
Samsn1	A	G	16: 75,883,845		probably benign	Het
Scrn1	A	G	6: 54,520,769	V279A	possibly damaging	Het
Sec31b	A	G	19: 44,531,746	S200P	probably benign	Het
Selp	A	G	1: 164,144,906	T705A	probably benign	Het
Slc2a1	G	A	4: 119,132,445	R61Q	probably damaging	Het
Slit3	G	A	11: 35,651,820		probably null	Het
Smo	T	A	6: 29,755,574	V415E	probably damaging	Het
Spag8	C	A	4: 43,652,035	V350L	possibly damaging	Het
Tbck	T	G	3: 132,707,798	L132R	possibly damaging	Het
Thnsl1	T	A	2: 21,212,045	C203*	probably null	Het
Tm9sf2	T	A	14: 122,149,840		probably null	Het
Tmem131	A	G	1: 36,841,676	V171A	probably damaging	Het
Tmem209	T	C	6: 30,501,955	T83A	probably benign	Het
Tmem63a	T	C	1: 180,954,851	Y138H	probably damaging	Het
Trim80	A	G	11: 115,447,943	Y533C	probably damaging	Het
Trpv2	A	G	11: 62,581,180	D66G	possibly damaging	Het
Trrap	T	A	5: 144,832,488	I2620N	probably benign	Het
Ttyh3	A	T	5: 140,634,786	I232N	probably damaging	Het
Ube2dnl1	G	A	X: 114,905,785	C119Y	possibly damaging	Het
Unc13c	T	A	9: 73,932,187	S461C	probably damaging	Het
Unc80	T	G	1: 66,527,941	I902S	probably damaging	Het
Usp42	C	A	5: 143,723,937	G170W	probably damaging	Het
Vldlr	T	C	19: 27,238,852		probably null	Het
Ywhab	A	G	2: 164,015,345	Y180C	probably damaging	Het
Zan	A	T	5: 137,380,850	C5329*	probably null	Het
Zbtb40	C	T	4: 136,998,642	M535I	probably benign	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp318	A	G	17: 46,412,062	T1664A	probably benign	Het
Zfp7	T	A	15: 76,891,346	C529*	probably null	Het
Zfp768	T	C	7: 127,343,375	Q527R	possibly damaging	Het
Zfp975	T	A	7: 42,665,146		probably null	Het

Other mutations in Isl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Isl1	APN	13	116303053	missense	probably benign	0.02
IGL03251:Isl1	APN	13	116305449	missense	probably benign
R1897:Isl1	UTSW	13	116303330	missense	probably benign	0.12
R1928:Isl1	UTSW	13	116308417	missense	probably damaging	1.00
R2940:Isl1	UTSW	13	116308299	missense	possibly damaging	0.53
R4062:Isl1	UTSW	13	116303090	missense	probably benign	0.27
R4796:Isl1	UTSW	13	116305430	missense	probably benign	0.41
R4836:Isl1	UTSW	13	116303083	missense	probably benign	0.06
R4839:Isl1	UTSW	13	116301684	missense	probably damaging	1.00
R4870:Isl1	UTSW	13	116308270	splice site	probably benign
R5231:Isl1	UTSW	13	116301657	missense	probably benign	0.17
R6220:Isl1	UTSW	13	116303267	missense	probably benign	0.24
R7231:Isl1	UTSW	13	116303290	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTATGATTTAGCCCCGCCTG -3'
(R):5'- CAGGCAGGTCAGGTTTATGG -3'

Sequencing Primer
(F):5'- AGGAGTACCTGCCATTTGC -3'
(R):5'- CAGGTTTATGGCCCGGGTCTC -3'

Posted On

2016-02-04