Incidental Mutation 'R4795:Mkl1'
ID368978
Institutional Source Beutler Lab
Gene Symbol Mkl1
Ensembl Gene ENSMUSG00000042292
Gene NameMKL (megakaryoblastic leukemia)/myocardin-like 1
SynonymsMal, MRTF-A, Bsac
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81012281-81190757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81017033 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 419 (S419N)
Ref Sequence ENSEMBL: ENSMUSP00000118451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000139517] [ENSMUST00000149582]
Predicted Effect probably benign
Transcript: ENSMUST00000109579
AA Change: S454N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292
AA Change: S454N

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124845
Predicted Effect probably benign
Transcript: ENSMUST00000131235
AA Change: S369N

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292
AA Change: S369N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134469
AA Change: S419N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292
AA Change: S419N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135047
AA Change: S419N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292
AA Change: S419N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138769
Predicted Effect probably benign
Transcript: ENSMUST00000139517
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145779
Predicted Effect probably benign
Transcript: ENSMUST00000149582
AA Change: S419N

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292
AA Change: S419N

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Mkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mkl1 APN 15 81016302 missense probably damaging 1.00
IGL02831:Mkl1 APN 15 81104793 missense probably benign 0.14
IGL03060:Mkl1 APN 15 81045322 missense probably damaging 1.00
Betcha UTSW 15 81018448 nonsense probably null
R0594:Mkl1 UTSW 15 81017174 missense probably damaging 1.00
R0648:Mkl1 UTSW 15 81016920 missense probably damaging 1.00
R1085:Mkl1 UTSW 15 81020883 missense probably damaging 1.00
R1476:Mkl1 UTSW 15 81018208 splice site probably benign
R4030:Mkl1 UTSW 15 81015784 missense probably benign 0.01
R4232:Mkl1 UTSW 15 81023595 missense probably damaging 1.00
R4307:Mkl1 UTSW 15 81016347 missense possibly damaging 0.88
R4400:Mkl1 UTSW 15 81020923 nonsense probably null
R4796:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4801:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4802:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4899:Mkl1 UTSW 15 81018386 missense probably damaging 1.00
R4967:Mkl1 UTSW 15 81045275 splice site probably benign
R5071:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5072:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5073:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5074:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R6186:Mkl1 UTSW 15 81016652 missense probably damaging 1.00
R6512:Mkl1 UTSW 15 81013716 missense probably benign
R6581:Mkl1 UTSW 15 81016373 missense probably damaging 1.00
R6997:Mkl1 UTSW 15 81018448 nonsense probably null
X0013:Mkl1 UTSW 15 81022436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTCACCATTTCACCAAAGGC -3'
(R):5'- TAACTCTCAACCCCTGCAGG -3'

Sequencing Primer
(F):5'- AAAGGCATCCCCAGGTGTG -3'
(R):5'- CTGAAGCAAGAACTGAAGTTGC -3'
Posted On2016-02-04