Incidental Mutation 'R4795:Parn'
ID368983
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Namepoly(A)-specific ribonuclease (deadenylation nuclease)
SynonymsDAN, 1200003I18Rik
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13537960-13668170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13606202 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 444 (T444A)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]
Predicted Effect probably benign
Transcript: ENSMUST00000058884
AA Change: T444A

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: T444A

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231003
Meta Mutation Damage Score 0.1388 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Vldlr T C 19: 27,238,852 probably null Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 splice site probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
R8188:Parn UTSW 16 13541156 missense probably benign 0.01
R8317:Parn UTSW 16 13541100 missense probably damaging 0.96
R8326:Parn UTSW 16 13665971 missense probably benign 0.00
R8419:Parn UTSW 16 13648474 missense probably benign 0.11
R8433:Parn UTSW 16 13667549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGAATTCACCCTGCATTTG -3'
(R):5'- AAAATCCCTGCTTTGCTTTGG -3'

Sequencing Primer
(F):5'- ACCCTGCATTTGGACTTAAACG -3'
(R):5'- TGGCACTGGCATTCGGAAC -3'
Posted On2016-02-04