Incidental Mutation 'R4795:Vldlr'
ID368997
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission 041996-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4795 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 27238852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably benign
Transcript: ENSMUST00000025866
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000047645
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047645
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably benign
Transcript: ENSMUST00000164746
SMART Domains Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 69 1.69e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167487
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172302
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (123/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,176,123 L2259R probably damaging Het
Acd A G 8: 105,701,015 S2P possibly damaging Het
Acsf3 A G 8: 122,780,157 Y63C possibly damaging Het
Adam21 T C 12: 81,560,974 I5V probably benign Het
Adamts6 C A 13: 104,444,128 S783* probably null Het
Adamtsl1 T C 4: 86,243,769 probably null Het
Adck2 T A 6: 39,576,393 S313T probably benign Het
Adgb A G 10: 10,357,872 I1285T probably benign Het
Angptl1 T A 1: 156,860,583 M485K possibly damaging Het
Ank3 G A 10: 69,858,265 V289I probably benign Het
Atp13a4 A G 16: 29,490,008 probably null Het
Atp1a1 A G 3: 101,583,775 L648P probably benign Het
Atp2a3 A G 11: 72,973,029 I194V probably benign Het
Bglap A C 3: 88,384,405 I4S unknown Het
Cacna1b T A 2: 24,637,487 T1621S possibly damaging Het
Ccdc112 T A 18: 46,287,672 Q337L probably benign Het
Cd34 T G 1: 194,951,011 S194A probably damaging Het
Cdh20 A G 1: 104,941,264 D160G probably damaging Het
Clock T C 5: 76,265,916 K44R probably damaging Het
Commd9 A G 2: 101,898,896 N116D probably benign Het
Dab2 C A 15: 6,429,611 P335T probably benign Het
Epb41l3 T A 17: 69,248,719 probably null Het
Epha2 A G 4: 141,322,416 probably null Het
Fam78b T C 1: 167,078,647 V125A probably benign Het
Fars2 A T 13: 36,537,426 E448V probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glyr1 A C 16: 5,047,758 V44G probably benign Het
Gm1527 A G 3: 28,920,663 I542V possibly damaging Het
Gm18856 C A 13: 13,965,208 probably benign Het
Gm44501 A G 17: 40,578,714 K40E probably benign Het
Gm6583 A G 5: 112,355,299 S180P possibly damaging Het
Hdhd5 T C 6: 120,523,446 H97R probably benign Het
Hmcn1 A G 1: 150,753,611 V965A probably benign Het
Hsf5 A G 11: 87,635,620 M373V probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Iigp1 T A 18: 60,389,892 F27L probably benign Het
Isl1 T C 13: 116,305,430 N89S probably benign Het
Itga1 C A 13: 115,035,385 W61C probably damaging Het
Itga5 T C 15: 103,347,760 R922G probably benign Het
Kbtbd3 G A 9: 4,331,073 W482* probably null Het
Kcnq1 A G 7: 143,182,757 T168A probably benign Het
Lrch3 A G 16: 33,005,704 N631S probably damaging Het
Lrrk1 T A 7: 66,262,665 I1716F possibly damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Map4 T C 9: 110,035,263 S519P probably benign Het
Mkl1 C T 15: 81,017,033 S419N probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Muc5b A G 7: 141,849,567 E755G unknown Het
Ncaph2 T G 15: 89,370,807 V478G probably damaging Het
Ncbp1 A G 4: 46,152,967 R247G possibly damaging Het
Necab1 G T 4: 15,111,208 D73E possibly damaging Het
Nedd9 T C 13: 41,317,900 K208E probably benign Het
Nfyb A T 10: 82,752,368 probably benign Het
Nol4 T C 18: 22,921,887 Q162R probably damaging Het
Nwd2 G A 5: 63,805,433 D787N probably benign Het
Olfr2 C T 7: 107,001,335 G175D probably damaging Het
Olfr205 C T 16: 59,328,850 V220I probably benign Het
Olfr49 A G 14: 54,282,547 M116T probably damaging Het
Olfr535 A G 7: 140,493,007 D123G probably damaging Het
Olfr713 A T 7: 107,036,914 Y253F probably benign Het
Olfr740 A C 14: 50,453,417 M122L probably damaging Het
Olfr908 T A 9: 38,516,503 M157K probably damaging Het
Orai3 T C 7: 127,773,888 V187A probably benign Het
Parn T C 16: 13,606,202 T444A probably benign Het
Pcdh11x A C X: 120,400,240 N460T probably damaging Het
Pcnt C T 10: 76,370,024 R2516H probably benign Het
Pde4d T A 13: 109,938,171 probably benign Het
Pdgfra A G 5: 75,189,311 N952S probably benign Het
Pgm1 A G 5: 64,103,874 Y237C probably damaging Het
Plcb2 A G 2: 118,711,124 V975A probably benign Het
Polk T C 13: 96,489,256 T347A probably benign Het
Ppp6r1 C T 7: 4,641,054 V430M possibly damaging Het
Ptges2 C A 2: 32,396,322 C16* probably null Het
Relb A T 7: 19,619,839 I38N probably damaging Het
Runx1t1 T A 4: 13,837,767 N51K probably damaging Het
Samsn1 A G 16: 75,883,845 probably benign Het
Scrn1 A G 6: 54,520,769 V279A possibly damaging Het
Sec31b A G 19: 44,531,746 S200P probably benign Het
Selp A G 1: 164,144,906 T705A probably benign Het
Slc2a1 G A 4: 119,132,445 R61Q probably damaging Het
Slit3 G A 11: 35,651,820 probably null Het
Smo T A 6: 29,755,574 V415E probably damaging Het
Spag8 C A 4: 43,652,035 V350L possibly damaging Het
Tbck T G 3: 132,707,798 L132R possibly damaging Het
Thnsl1 T A 2: 21,212,045 C203* probably null Het
Tm9sf2 T A 14: 122,149,840 probably null Het
Tmem131 A G 1: 36,841,676 V171A probably damaging Het
Tmem209 T C 6: 30,501,955 T83A probably benign Het
Tmem63a T C 1: 180,954,851 Y138H probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Trpv2 A G 11: 62,581,180 D66G possibly damaging Het
Trrap T A 5: 144,832,488 I2620N probably benign Het
Ttyh3 A T 5: 140,634,786 I232N probably damaging Het
Ube2dnl1 G A X: 114,905,785 C119Y possibly damaging Het
Unc13c T A 9: 73,932,187 S461C probably damaging Het
Unc80 T G 1: 66,527,941 I902S probably damaging Het
Usp42 C A 5: 143,723,937 G170W probably damaging Het
Ywhab A G 2: 164,015,345 Y180C probably damaging Het
Zan A T 5: 137,380,850 C5329* probably null Het
Zbtb40 C T 4: 136,998,642 M535I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp318 A G 17: 46,412,062 T1664A probably benign Het
Zfp7 T A 15: 76,891,346 C529* probably null Het
Zfp768 T C 7: 127,343,375 Q527R possibly damaging Het
Zfp975 T A 7: 42,665,146 probably null Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
R7658:Vldlr UTSW 19 27243136 missense probably benign 0.33
R7754:Vldlr UTSW 19 27217615 start codon destroyed probably benign 0.01
R8105:Vldlr UTSW 19 27238804 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAACGGTGAGGTTCTTTCTCC -3'
(R):5'- CAACCCTGAGTTAGTTTGTCATGG -3'

Sequencing Primer
(F):5'- GGCTATTGGCTACTCCTGTCAGAAC -3'
(R):5'- GTTTGTCATGGGCTAAAATTCCAC -3'
Posted On2016-02-04