Incidental Mutation 'R0418:Aldh1a1'
ID36900
Institutional Source Beutler Lab
Gene Symbol Aldh1a1
Ensembl Gene ENSMUSG00000053279
Gene Namealdehyde dehydrogenase family 1, subfamily A1
SynonymsAhd-2, Ahd2, ALDH1, Raldh1, E1
MMRRC Submission 038620-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R0418 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location20492715-20643462 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 20629049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087638]
Predicted Effect probably benign
Transcript: ENSMUST00000087638
SMART Domains Protein: ENSMUSP00000084918
Gene: ENSMUSG00000053279

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 5.1e-185 PFAM
Pfam:LuxC 147 368 2.4e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene show a significantly reduced ability to convert retinol to retinoic acid in the liver. Retinal morphology is normal even though the gene is normally highly expressed in the dorsal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik G T 2: 104,123,330 probably null Het
Abca14 T C 7: 120,207,434 L19P probably damaging Het
Abcb1a T A 5: 8,713,281 V603E probably damaging Het
Acsl5 A G 19: 55,272,806 D65G probably benign Het
Acss3 T C 10: 107,023,912 Y311C probably damaging Het
Ak8 T G 2: 28,733,856 I151S possibly damaging Het
Aldh1l1 A G 6: 90,569,893 R393G possibly damaging Het
Ankhd1 T A 18: 36,634,300 L1164Q probably damaging Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atf5 A G 7: 44,813,397 M101T possibly damaging Het
C77080 A G 4: 129,223,684 S396P probably damaging Het
Det1 T C 7: 78,844,017 T80A probably benign Het
Dpp9 C T 17: 56,194,404 probably benign Het
Fam13c A G 10: 70,534,761 R244G probably damaging Het
Fat3 A T 9: 16,246,896 N1139K probably damaging Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fli1 T C 9: 32,452,129 probably benign Het
Glb1l2 T G 9: 26,794,101 D151A probably damaging Het
Gli2 G A 1: 118,840,490 T669I possibly damaging Het
Igsf3 C A 3: 101,435,435 R463S probably damaging Het
Il1rl2 T C 1: 40,326,502 V3A unknown Het
Irx3 G A 8: 91,800,080 S332F probably benign Het
Katnb1 C T 8: 95,095,658 T303M possibly damaging Het
Lrrc31 A T 3: 30,689,234 L194Q probably damaging Het
Lrrc37a T G 11: 103,503,438 E387A probably benign Het
Mapk14 T C 17: 28,691,789 I17T probably benign Het
Mtif2 A G 11: 29,533,401 probably benign Het
Myo16 A G 8: 10,569,918 T1490A probably benign Het
Nfasc A G 1: 132,611,595 V399A probably damaging Het
Nobox T C 6: 43,307,235 K1E probably null Het
Nr2c1 A T 10: 94,181,512 M371L probably benign Het
Olfr1330 C T 4: 118,893,251 T56I possibly damaging Het
Olfr642 G A 7: 104,049,772 T194I probably benign Het
Oplah C T 15: 76,298,487 R924H probably benign Het
Pappa2 C A 1: 158,716,990 C1756F probably damaging Het
Pdzd8 G A 19: 59,300,929 R680C probably damaging Het
Rassf3 G A 10: 121,417,170 T44M probably benign Het
Rmnd1 T C 10: 4,427,693 probably null Het
Rnf126 C T 10: 79,762,643 probably benign Het
Rnf144b T C 13: 47,244,490 S299P probably benign Het
Ryr2 A G 13: 11,834,095 probably benign Het
Scel T A 14: 103,603,254 S511T probably benign Het
Slc16a10 G T 10: 40,040,631 S138* probably null Het
Slc36a4 A T 9: 15,734,266 I330F probably damaging Het
Slc5a8 A G 10: 88,886,558 I84M probably benign Het
Spag9 T C 11: 94,091,753 probably benign Het
Suco C T 1: 161,834,850 V671I probably benign Het
Suox G A 10: 128,670,885 P425S probably damaging Het
Tmem266 T A 9: 55,437,413 V443E probably benign Het
Tmprss11f A T 5: 86,557,011 I16N probably benign Het
Tnik T A 3: 28,570,880 Y321* probably null Het
Tnrc6b T C 15: 80,913,323 M1357T probably benign Het
Tpbg C A 9: 85,844,750 Y257* probably null Het
Usp37 A T 1: 74,490,107 S138T probably benign Het
Veph1 T A 3: 66,255,028 R70* probably null Het
Vmn2r17 C T 5: 109,452,881 P682S probably damaging Het
Vmn2r79 A C 7: 87,002,403 N337H probably benign Het
Vstm2b A G 7: 40,902,452 D68G probably damaging Het
Vwa7 G T 17: 35,017,957 A167S possibly damaging Het
Zfp647 A T 15: 76,911,386 I358N probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Aldh1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aldh1a1 APN 19 20619997 missense probably benign 0.13
IGL01769:Aldh1a1 APN 19 20642919 missense probably benign 0.29
IGL02745:Aldh1a1 APN 19 20636664 splice site probably benign
IGL02989:Aldh1a1 APN 19 20640058 splice site probably benign
IGL03154:Aldh1a1 APN 19 20630768 missense probably benign 0.21
LCD18:Aldh1a1 UTSW 19 20626646 intron probably benign
R0265:Aldh1a1 UTSW 19 20640076 nonsense probably null
R0282:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0471:Aldh1a1 UTSW 19 20602013 start codon destroyed probably null 0.99
R0556:Aldh1a1 UTSW 19 20634478 missense probably damaging 1.00
R0755:Aldh1a1 UTSW 19 20617994 missense probably benign
R1164:Aldh1a1 UTSW 19 20617946 missense probably benign 0.11
R1692:Aldh1a1 UTSW 19 20630818 missense probably damaging 1.00
R1905:Aldh1a1 UTSW 19 20617998 missense probably damaging 1.00
R2127:Aldh1a1 UTSW 19 20642915 missense probably benign 0.00
R2281:Aldh1a1 UTSW 19 20620091 missense possibly damaging 0.88
R2475:Aldh1a1 UTSW 19 20640078 missense probably benign
R3871:Aldh1a1 UTSW 19 20624753 nonsense probably null
R4607:Aldh1a1 UTSW 19 20621687 missense probably benign 0.35
R4725:Aldh1a1 UTSW 19 20640081 missense probably benign
R4791:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4792:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4844:Aldh1a1 UTSW 19 20634400 missense probably benign 0.00
R5639:Aldh1a1 UTSW 19 20623422 missense probably damaging 1.00
R5669:Aldh1a1 UTSW 19 20610920 missense probably damaging 1.00
R5815:Aldh1a1 UTSW 19 20630670 missense probably benign 0.00
R6387:Aldh1a1 UTSW 19 20617959 missense probably damaging 0.99
R7078:Aldh1a1 UTSW 19 20602070 missense probably benign
R7282:Aldh1a1 UTSW 19 20629070 missense possibly damaging 0.68
R7334:Aldh1a1 UTSW 19 20621711 missense probably damaging 1.00
R7578:Aldh1a1 UTSW 19 20618002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCCTCTCATGCAAGTCAAGTCTC -3'
(R):5'- ACTGTGACAGGATCAGGCATCAGG -3'

Sequencing Primer
(F):5'- GCAAGTCAAGTCTCTCTAGGTAACTG -3'
(R):5'- TCAGGAGGAAGATGATGAGATGC -3'
Posted On2013-05-09